ID: 1007406034

View in Genome Browser
Species Human (GRCh38)
Location 6:41637042-41637064
Sequence GCCGGGATCCGGCTGCTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007406034_1007406045 10 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406045 6:41637075-41637097 GGCACTAGGACAGACCCCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 78
1007406034_1007406053 29 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406053 6:41637094-41637116 GCGGCTAGCAGCCCGGCCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 122
1007406034_1007406054 30 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406054 6:41637095-41637117 CGGCTAGCAGCCCGGCCTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 209
1007406034_1007406051 27 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406051 6:41637092-41637114 CCGCGGCTAGCAGCCCGGCCTGG 0: 1
1: 0
2: 3
3: 16
4: 130
1007406034_1007406052 28 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406052 6:41637093-41637115 CGCGGCTAGCAGCCCGGCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 103
1007406034_1007406046 22 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406046 6:41637087-41637109 GACCCCCGCGGCTAGCAGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1007406034_1007406042 -4 Left 1007406034 6:41637042-41637064 CCGGACAGCAGCCGGATCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1007406042 6:41637061-41637083 CGGCCGGCTCCTGGGGCACTAGG 0: 1
1: 0
2: 0
3: 8
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007406034 Original CRISPR GCCGGGATCCGGCTGCTGTC CGG (reversed) Intronic
900379262 1:2375746-2375768 GCAGAGGCCCGGCTGCTGTCTGG + Intronic
900633182 1:3649593-3649615 GCCGGGGTCCTGCACCTGTCCGG + Intronic
902187136 1:14733917-14733939 GCCGGGAACCGACAGCAGTCTGG - Intronic
902333481 1:15742339-15742361 GCCTGGAGCCAGCTGCTGCCCGG - Intergenic
902354373 1:15886484-15886506 GCAGGGACCCGGCTGCTGCGTGG + Intronic
903053665 1:20620146-20620168 TCGGGGAGCCTGCTGCTGTCTGG + Intergenic
904814028 1:33181941-33181963 GCCGGGATCCGGCAGCTGAGCGG - Intronic
905416702 1:37808710-37808732 GCCCGGAGCCGGCTGGTGGCGGG + Exonic
905888818 1:41507291-41507313 GCAGGCAGCTGGCTGCTGTCGGG + Exonic
907519099 1:55011688-55011710 GCTCTGAACCGGCTGCTGTCAGG + Intergenic
915290277 1:154878734-154878756 GCCGGGGTTCAGATGCTGTCTGG - Intergenic
920190482 1:204190614-204190636 GCGGGGATCTGGCGGCTGTGGGG + Exonic
922720063 1:227895840-227895862 GCCGGGCCCCGGGTGCTGCCTGG - Intergenic
922985659 1:229864285-229864307 GCTGGGATGCCGCTTCTGTCTGG - Intergenic
924511287 1:244730807-244730829 GCGGGGATCCGGAGGCGGTCGGG - Intergenic
1066464843 10:35642115-35642137 GCCGCGCTCCGGCCGCAGTCGGG + Exonic
1071522706 10:86340987-86341009 GCCTGGATCTGTCTGCTGTAGGG - Intronic
1074104432 10:110377774-110377796 GCTGGGATCCAGCTGCTGGGTGG - Intergenic
1075928571 10:126273592-126273614 TTCGGGATCCAGCTGCTGTAGGG - Intronic
1076320944 10:129580936-129580958 GCCCAGATCCAGCCGCTGTCTGG + Intronic
1077227743 11:1445712-1445734 ACCGGGGTCCGGGGGCTGTCTGG + Intronic
1077527657 11:3077230-3077252 GCCGTGTTCCGTCTGCTGTGAGG - Intergenic
1079035490 11:17015929-17015951 GCTGGGCTCCAGCTGTTGTCAGG + Intergenic
1082824482 11:57567800-57567822 GCGGGGATCGGGCGGTTGTCCGG - Exonic
1084183609 11:67458695-67458717 GCCTGGGTCTGGCTGGTGTCTGG - Exonic
1090678109 11:129024043-129024065 GCCGGGTTCCAGCTGTTTTCAGG + Intronic
1091243319 11:134069436-134069458 CCCGGGGTCCGACGGCTGTCCGG - Intronic
1091312707 11:134585965-134585987 GCCTGGATCGGGGTGCTTTCTGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1103049722 12:117768603-117768625 GCTGGGCTCCTGCTGCTGCCGGG - Intronic
1103623676 12:122203813-122203835 GCCGGGACGCCGCTGCTGTGAGG + Intronic
1104034934 12:125091610-125091632 GCTGGGCTCACGCTGCTGTCCGG - Intronic
1104900769 12:132188556-132188578 GCCAGGAGCCGTCTGCTGCCCGG + Intergenic
1105007964 12:132734793-132734815 GCCGTGAACCGGCTGCAGGCAGG + Intronic
1109825256 13:67710717-67710739 GCTGAGACCCGGCTGCTGTGGGG + Intergenic
1115814916 14:37153417-37153439 GCCAGGAAGCGGGTGCTGTCAGG + Intronic
1117377624 14:55129960-55129982 GCCGGGCTGCAGCCGCTGTCTGG + Intronic
1122131024 14:99604521-99604543 GCCGGGAGCCGGCCGCGGGCGGG - Intergenic
1122968643 14:105143592-105143614 CCCTGGATCAGGCTGCTGTCAGG + Exonic
1125728986 15:41882365-41882387 CCCGGGATCCGGCTGCGTTGGGG + Exonic
1129631692 15:77267199-77267221 GCAGGGATGTGGCTGCTGTAGGG - Intronic
1131423524 15:92326802-92326824 GTGGGGATCAGGCAGCTGTCTGG + Intergenic
1132891162 16:2205535-2205557 GCCGGGAACCGGCTGCTGGGTGG + Intronic
1133179776 16:4044904-4044926 GCCGGGAGCCCGTTGCTGTGAGG - Intronic
1142385431 16:89760917-89760939 GCTGGGCTATGGCTGCTGTCCGG - Intronic
1144585935 17:16487806-16487828 TCCTGGTTCCTGCTGCTGTCTGG - Intronic
1144728685 17:17514594-17514616 GCCCTGATCCTGCTGCTGCCCGG + Intronic
1144946376 17:18971554-18971576 GCCGGGATCCGGAAGCAGGCGGG + Exonic
1146591608 17:34132375-34132397 GACGGGTTGCGGCTGCTGGCTGG + Intronic
1147192833 17:38747617-38747639 GCCGGGGTCCGGGTCCTCTCGGG - Intronic
1153759513 18:8317107-8317129 GCCGTGATCTGGCTGCTGGGAGG + Intronic
1163680383 19:18678140-18678162 GCGGGGCTTGGGCTGCTGTCTGG + Intergenic
1163824490 19:19515451-19515473 GGCAGGAGGCGGCTGCTGTCGGG + Exonic
1164936984 19:32222865-32222887 GCCAGGATGCTGCTGCTGCCGGG - Intergenic
1167377464 19:49119621-49119643 GCCGGGCCCCGGCCGCTGCCAGG + Exonic
927890075 2:26742624-26742646 GCCGGGGCCAGGCTGCTGTCAGG + Intergenic
933093027 2:78145650-78145672 CCCGGGAGCCCGCTGCTGTGGGG + Intergenic
934060000 2:88284395-88284417 GGCGGGATCCGGCTGTTCGCGGG + Intergenic
934534530 2:95121953-95121975 GCCGGGCTCCGCCTGCAGTGTGG - Exonic
938766563 2:134463869-134463891 GTCGGGATCCTGCTGCCGTCAGG - Intronic
939057589 2:137382890-137382912 GCCAGGATGCTGCTGCTGCCTGG + Intronic
942560014 2:177210262-177210284 GCCGAGATCACGCTGCTGGCTGG - Intergenic
944159000 2:196639562-196639584 GCCGGCATCCGGCGGCGCTCAGG - Intronic
944465820 2:199998357-199998379 GCCTGGACCCTCCTGCTGTCTGG - Intronic
946019900 2:216633766-216633788 GCCGGGCTGCGGCTGCTGCTCGG + Exonic
947736730 2:232459105-232459127 GCCGGGACCCTGCTGCTGCTGGG + Exonic
948830003 2:240594060-240594082 GCCTGGACCATGCTGCTGTCGGG + Intronic
948992893 2:241563729-241563751 GCCTGGCTCCTGCTGCTGTCAGG - Intronic
1175240218 20:57541952-57541974 GCCAGGAACCTGGTGCTGTCAGG + Intergenic
1179623359 21:42633104-42633126 GGAGGGATACGGCTGGTGTCTGG - Intergenic
1181685269 22:24523666-24523688 CCAGGAGTCCGGCTGCTGTCAGG - Exonic
1184580456 22:45413309-45413331 GCCGGGATCCGGTCGCGGTCAGG + Intronic
1184659673 22:45960095-45960117 GCCATGATCCTGCTGGTGTCAGG - Intronic
1184865012 22:47197426-47197448 TCCGGGATCCTGCTCCTGCCTGG + Intergenic
950345392 3:12288045-12288067 CTCGGGAACCGGCTGCTGGCTGG + Intronic
950433922 3:12967521-12967543 CCCGGGATCCGGCGGCTCGCTGG - Exonic
952054459 3:29427826-29427848 GCCGGCATCTGGTTGCTGGCAGG - Intronic
952886887 3:38017630-38017652 GCCTGGATCCTGCTGCTGGGAGG - Intronic
954456913 3:50604628-50604650 GCCAGGGCCCGGCTCCTGTCTGG - Intergenic
955979792 3:64513195-64513217 GCCGAGATCAAGGTGCTGTCAGG - Intergenic
958871226 3:99561421-99561443 GGAGGGAACCAGCTGCTGTCTGG + Intergenic
961613689 3:128161880-128161902 GCCTGGAGCAGGCTGCTTTCCGG - Intronic
962855221 3:139339183-139339205 CCCAAGATCTGGCTGCTGTCAGG - Intronic
964379884 3:156087620-156087642 GCCGGGTGCCGGCTGCAGTGAGG - Intronic
968583367 4:1404991-1405013 GCCGGGATCCCGCTGAAGCCGGG - Intronic
968668265 4:1833502-1833524 GCCGGGACCCTGCTGCTCTGGGG + Intronic
969571398 4:8010806-8010828 GCCGGGTGACGGCTGTTGTCTGG - Intronic
973982271 4:56316314-56316336 GCCGGGGTCTGGCTGCTGGCCGG - Exonic
985542006 5:491721-491743 GCCGGGATCAGGGTGGGGTCCGG - Intronic
992104155 5:73436666-73436688 GCCGGGCTCCGGCTGTGGGCGGG - Intergenic
998095931 5:139395432-139395454 GCAGGGATCCGCCTGAAGTCAGG + Exonic
999188408 5:149730030-149730052 GCAGGCATCGGGCTGCTGGCTGG + Intergenic
1001532973 5:172477704-172477726 CCCGGAATTCTGCTGCTGTCTGG + Intergenic
1001545015 5:172565658-172565680 TCCGGGATCGGGGTGCTGCCAGG + Intergenic
1002455923 5:179345334-179345356 GCGGGGCCCCGGCTGCAGTCCGG - Exonic
1002566876 5:180117098-180117120 CCCGGGCTCCGGCTCCTGGCAGG + Intronic
1002898164 6:1390875-1390897 ACCGGGCTGCTGCTGCTGTCCGG - Exonic
1007406034 6:41637042-41637064 GCCGGGATCCGGCTGCTGTCCGG - Intronic
1018642767 6:165919678-165919700 GCCTGGATAGGCCTGCTGTCTGG + Intronic
1023863773 7:44229358-44229380 GCCTGGGTCCTGCTGCTGTGGGG - Intronic
1029504032 7:100951393-100951415 CCCGGCACCCTGCTGCTGTCTGG - Intronic
1031629689 7:124032343-124032365 GCCGGGCTCCGGCCGCAGTAGGG + Exonic
1034921920 7:155090389-155090411 CCCTGGATCAGGCTGCTGCCTGG + Intergenic
1035075131 7:156172777-156172799 GCCTGGTGGCGGCTGCTGTCAGG - Intergenic
1035727689 8:1834899-1834921 GCCGGGAGCCGGCTGCTGGGTGG - Intronic
1045738194 8:105319670-105319692 GCGGGGATTCGGGTGGTGTCTGG + Intronic
1047499661 8:125431277-125431299 GCCAGGACCCGGCTGGGGTCGGG + Intronic
1049155464 8:141063646-141063668 GCTGGGATCGTGCTACTGTCTGG + Intergenic
1049176640 8:141196927-141196949 GCCTGGATCAGGCTCCCGTCCGG - Intergenic
1049273140 8:141706708-141706730 GTCGGGATCCTTCTGCAGTCAGG + Intergenic
1049386235 8:142344436-142344458 TCCGGCATCCGGCTGCCTTCAGG + Exonic
1060219080 9:121754966-121754988 GCTGGGATTGGGCTGCTTTCTGG - Intronic
1060756886 9:126220046-126220068 GCCTGGATCCTGCTGCTCTTTGG - Intergenic
1062519646 9:136952322-136952344 GCCAGGATGAGGCTGCTGTGTGG + Exonic
1186204877 X:7190722-7190744 GCCATGATCATGCTGCTGTCTGG + Intergenic
1196995112 X:121373775-121373797 GCTGGGAGCCTGATGCTGTCTGG + Intergenic
1198530598 X:137547374-137547396 TCCGGGAGCCGGCTGCTCTTAGG - Intergenic