ID: 1007407180

View in Genome Browser
Species Human (GRCh38)
Location 6:41641845-41641867
Sequence CCCCTACTCCCTGTTGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007407168_1007407180 26 Left 1007407168 6:41641796-41641818 CCCATGGGCACTGTGCAGGCTTG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG No data
1007407175_1007407180 -8 Left 1007407175 6:41641830-41641852 CCGGAAAGAGGTTCCCCCCTACT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG No data
1007407173_1007407180 -4 Left 1007407173 6:41641826-41641848 CCCACCGGAAAGAGGTTCCCCCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG No data
1007407174_1007407180 -5 Left 1007407174 6:41641827-41641849 CCACCGGAAAGAGGTTCCCCCCT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG No data
1007407172_1007407180 0 Left 1007407172 6:41641822-41641844 CCATCCCACCGGAAAGAGGTTCC 0: 1
1: 0
2: 1
3: 4
4: 56
Right 1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG No data
1007407169_1007407180 25 Left 1007407169 6:41641797-41641819 CCATGGGCACTGTGCAGGCTTGA 0: 1
1: 0
2: 1
3: 9
4: 203
Right 1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007407180 Original CRISPR CCCCTACTCCCTGTTGGTCC AGG Intronic
No off target data available for this crispr