ID: 1007407469

View in Genome Browser
Species Human (GRCh38)
Location 6:41643291-41643313
Sequence CTTGACACACTCAGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007407465_1007407469 -10 Left 1007407465 6:41643278-41643300 CCCAGGAAGCCTGCTTGACACAC 0: 1
1: 0
2: 0
3: 20
4: 181
Right 1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG No data
1007407463_1007407469 -5 Left 1007407463 6:41643273-41643295 CCTGCCCCAGGAAGCCTGCTTGA 0: 1
1: 0
2: 2
3: 42
4: 372
Right 1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG No data
1007407464_1007407469 -9 Left 1007407464 6:41643277-41643299 CCCCAGGAAGCCTGCTTGACACA 0: 1
1: 0
2: 0
3: 20
4: 186
Right 1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007407469 Original CRISPR CTTGACACACTCAGCCATCT GGG Intronic
No off target data available for this crispr