ID: 1007407588

View in Genome Browser
Species Human (GRCh38)
Location 6:41643928-41643950
Sequence GGGGGACCTGACTCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007407588_1007407592 -7 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407592 6:41643944-41643966 GTCCCCCAGTTCAGGGCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 205
1007407588_1007407597 4 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407597 6:41643955-41643977 CAGGGCCCAGGGCCATAGCAAGG 0: 1
1: 0
2: 4
3: 59
4: 402
1007407588_1007407602 15 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407602 6:41643966-41643988 GCCATAGCAAGGTGCCTCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 127
1007407588_1007407604 16 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407604 6:41643967-41643989 CCATAGCAAGGTGCCTCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 119
1007407588_1007407591 -8 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407591 6:41643943-41643965 GGTCCCCCAGTTCAGGGCCCAGG 0: 1
1: 0
2: 3
3: 15
4: 222
1007407588_1007407601 14 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407601 6:41643965-41643987 GGCCATAGCAAGGTGCCTCTGGG No data
1007407588_1007407600 13 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407600 6:41643964-41643986 GGGCCATAGCAAGGTGCCTCTGG No data
1007407588_1007407605 21 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407605 6:41643972-41643994 GCAAGGTGCCTCTGGGGGCCAGG 0: 1
1: 0
2: 3
3: 26
4: 333
1007407588_1007407607 27 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407607 6:41643978-41644000 TGCCTCTGGGGGCCAGGGTCCGG No data
1007407588_1007407606 22 Left 1007407588 6:41643928-41643950 CCTGTGGGAGAGTCAGGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1007407606 6:41643973-41643995 CAAGGTGCCTCTGGGGGCCAGGG 0: 1
1: 0
2: 5
3: 22
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007407588 Original CRISPR GGGGGACCTGACTCTCCCAC AGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900405547 1:2491390-2491412 GGGGGCCCTGGCTGGCCCACAGG - Intronic
900565035 1:3328018-3328040 TGGGGACCGGAATCCCCCACAGG + Intronic
901815731 1:11792379-11792401 CAGGCACCTGTCTCTCCCACAGG - Exonic
901889543 1:12250793-12250815 GGGGAACCAGACTCGGCCACCGG - Intronic
902098008 1:13962289-13962311 GGGGGAGGTGACTCTCACAAGGG + Intergenic
902962405 1:19974285-19974307 GTGGGAGCTGAGTTTCCCACAGG - Intergenic
904612683 1:31733969-31733991 GCTGTGCCTGACTCTCCCACTGG - Intronic
906518496 1:46453465-46453487 GGGTGACCTGACTCCACCCCAGG - Intergenic
912062009 1:105685877-105685899 GGGGTAGCTGAGTCTCCCAGGGG + Intergenic
914095762 1:144543323-144543345 GGAGGACCTGACCCTACCCCTGG + Intergenic
914302758 1:146390646-146390668 GGAGGACCTGACCCTACCCCTGG - Intergenic
914376954 1:147080267-147080289 GGGAGACCTCGCTTTCCCACCGG + Intergenic
915070359 1:153261200-153261222 GGAGTACTTGACGCTCCCACCGG - Exonic
920377931 1:205519233-205519255 TGAGGAGCTGACTCTCCCAAGGG + Intronic
920557175 1:206912722-206912744 AGGGGACCTGACTGTCGGACAGG + Intronic
922927140 1:229359002-229359024 GGGGGACTTCAATCTTCCACTGG - Intergenic
923045658 1:230354008-230354030 GGTGGGCCTGGCTCTCCCAGGGG - Intronic
923934732 1:238747947-238747969 GAGGGAGCTGAATCTCCCACTGG - Intergenic
1062943006 10:1438664-1438686 GGGGCTCCTGAGTCTCCCCCCGG + Intronic
1062943167 10:1439391-1439413 GGGGCTCCTGAGTCTCCCCCAGG + Intronic
1062943296 10:1439984-1440006 GGGGCTCCTGAGTCTCCCCCAGG + Intronic
1062943325 10:1440121-1440143 GGGGCTCCTGAGTCTCCCCCAGG + Intronic
1063374337 10:5545096-5545118 GGGGGACCTCACTGTCCTCCTGG - Intergenic
1067551847 10:47241902-47241924 TGAGAAGCTGACTCTCCCACTGG + Intergenic
1069987098 10:72291916-72291938 GGGGGACCTGCTGCTCCCAGAGG + Intergenic
1072906786 10:99461493-99461515 GGAGGAGCTGACTCTTCCAGGGG - Intergenic
1073073509 10:100809308-100809330 GGGGGACCTGCTCCTCACACTGG - Intronic
1075643708 10:124084159-124084181 GGAGGAGCTGACCCTCCCAAGGG + Intronic
1076563775 10:131384658-131384680 GGGGACGCTGACACTCCCACTGG + Intergenic
1083430255 11:62610768-62610790 GGGGGACCTGATTGCCCAACAGG - Intronic
1083875770 11:65523888-65523910 GGGGGACCTAACGCACCCAAAGG + Intergenic
1084118292 11:67054511-67054533 GAGGGGCCTAAGTCTCCCACAGG + Intergenic
1092195750 12:6548744-6548766 GGGGCCCCTCACTCTCCGACAGG + Exonic
1097818992 12:64108284-64108306 GGGGGAGCTCACCATCCCACAGG + Intronic
1101250677 12:102931657-102931679 GGGGCAACTGACTCTCCCCAGGG - Intronic
1104387560 12:128364420-128364442 GGGGGACCCGTCGCTCACACAGG + Intronic
1104394516 12:128420803-128420825 GGAAAACCTGCCTCTCCCACAGG - Intronic
1106922084 13:34574531-34574553 GGGGCACCACTCTCTCCCACAGG + Intergenic
1113597998 13:111547977-111547999 GGGGGGCCTGACAGTCCCACAGG - Intergenic
1121248496 14:92482395-92482417 GGGGGAACAGACTCACCCAGAGG - Intronic
1122202549 14:100131314-100131336 GAGGGCCTTGACTCTCCCACCGG - Intronic
1122393709 14:101407927-101407949 GTGGTATCTGCCTCTCCCACGGG + Intergenic
1122933701 14:104946306-104946328 GGTGGACCTGAAGCTCCCAGAGG - Exonic
1123753381 15:23376285-23376307 GGGGCACCTCACTCTCCTCCAGG + Intergenic
1124395290 15:29295299-29295321 GGGGGACCTGGCCCTCCCTGAGG - Intronic
1125970039 15:43904081-43904103 GGGGTTCCTGACCCTCCCAGCGG - Intronic
1126567247 15:50113146-50113168 GGGTGACCTTGCTGTCCCACAGG + Intronic
1129273775 15:74432921-74432943 GGGGGACTGGAGTCTCCCCCAGG - Intronic
1131268049 15:90930261-90930283 GGGGAACCGGAATCCCCCACCGG + Exonic
1132097358 15:98997769-98997791 GGGGGAAATGACTTTCCCCCGGG + Intronic
1133772577 16:8875918-8875940 TGGGGGTCTGACTCTGCCACTGG + Intergenic
1134008321 16:10833203-10833225 GGGGGTCCTGTTTCTCCCAGGGG - Intergenic
1134136147 16:11677575-11677597 TCAGGACTTGACTCTCCCACAGG + Exonic
1137699297 16:50484833-50484855 GGGGGTCCCGAGTCTCCCAAGGG - Intergenic
1138233898 16:55363384-55363406 GGGAGACATGAGTCTCCCCCAGG - Intergenic
1139336488 16:66235515-66235537 GGGAGACATGCCTCTTCCACGGG - Intergenic
1144206319 17:12982083-12982105 AGGAGCCCTGGCTCTCCCACTGG - Intronic
1144424812 17:15131939-15131961 GGAGTACATGACACTCCCACCGG - Intergenic
1145076942 17:19863433-19863455 TGGGGACCTGAGACTCCCAGAGG - Intronic
1145262859 17:21365134-21365156 GGGGAGCCTGCCTCTCCCAGTGG + Intergenic
1149495026 17:57112091-57112113 GAGGGACCTGAGTCTCCCGCAGG - Intronic
1150009775 17:61492977-61492999 GGCAGAGCTGACTCACCCACAGG - Intergenic
1152408950 17:80112374-80112396 GGGGGTCCTGGCTCACCTACAGG + Intergenic
1152577829 17:81150647-81150669 TGGGGACCTGAGGCTCCCCCTGG + Intronic
1158946154 18:62448625-62448647 CGGAGGCCTGATTCTCCCACTGG + Intergenic
1159947453 18:74454940-74454962 GGGGGAGCAGACTTTGCCACAGG - Intronic
1160558509 18:79741246-79741268 GGGGGACCTCACCCAACCACAGG - Intronic
1161596625 19:5154090-5154112 GGGAGACCTGAGCCTCCCTCAGG + Intergenic
1162706093 19:12555730-12555752 GGGGGACCTCTCTGTCCCAGTGG + Intronic
1163104343 19:15114890-15114912 AGGGAACCGTACTCTCCCACTGG - Exonic
1163534680 19:17870320-17870342 GGTGGACCTGTCCCTCCCCCGGG - Intergenic
1163557670 19:18001708-18001730 CGGGGTCCTGACCCTCCCACAGG + Intronic
1163727545 19:18931443-18931465 GGGGGTCCTGGCTTTCCCACAGG + Intronic
1166130867 19:40744804-40744826 GGGAGACCTGACTCCCCTTCAGG + Intronic
1166862531 19:45818455-45818477 GGGGGCCCTGCCACTCCCCCAGG - Intronic
925918449 2:8623648-8623670 GGGGGTCCTGACTCTGACTCGGG - Intergenic
926994429 2:18718664-18718686 ACGGTACCTCACTCTCCCACTGG - Intergenic
927198753 2:20565617-20565639 GGGTGTGCTGACTGTCCCACGGG - Intronic
932856771 2:75241810-75241832 GGGAGAGCTGACTCCCTCACCGG - Intergenic
934888002 2:98041315-98041337 GGGGGACCTGAATGTCAGACAGG + Intergenic
934992771 2:98933131-98933153 CGGGGACCTGGCTCTTCCATTGG - Intronic
935341583 2:102064083-102064105 GGGAGGCCTAACTCTCCCTCTGG - Intergenic
935348084 2:102127178-102127200 TGGGGAGCTGACTCACCCAATGG - Intronic
938729098 2:134131983-134132005 GGGTTACCTGAATCACCCACTGG + Intronic
945510082 2:210690365-210690387 GGGGGTCCTGAGTTGCCCACAGG + Intergenic
946245007 2:218382475-218382497 GGGGGACCAGAGGCTTCCACAGG - Intronic
947396910 2:229695669-229695691 TGGGGAACTCACTCTACCACTGG - Intronic
947530407 2:230905500-230905522 GGGGGACCTGCATCTCCACCGGG - Intergenic
1172119477 20:32589394-32589416 GGTGGCCCTGACTGTGCCACAGG + Intronic
1173101028 20:40088774-40088796 TGGGGATCTGACTCCCTCACTGG - Intergenic
1174368905 20:50073229-50073251 GGGGCACTAGAATCTCCCACTGG + Intergenic
1174882009 20:54290177-54290199 GGGTGTCCTGACTATCCAACTGG + Intergenic
1175242107 20:57557271-57557293 AGTGGCCCTGGCTCTCCCACTGG + Intergenic
1176386548 21:6140980-6141002 AAGGGGCCTGGCTCTCCCACGGG - Intergenic
1179513739 21:41892292-41892314 GCGGGAGCAGGCTCTCCCACAGG + Intronic
1179736925 21:43397272-43397294 AAGGGGCCTGGCTCTCCCACGGG + Intergenic
1179893547 21:44349741-44349763 TGGGGTCCTGCCTCTCTCACTGG + Intergenic
1180231060 21:46426940-46426962 GGTGGGGCTGACCCTCCCACCGG - Intronic
1181148707 22:20867281-20867303 CAGGGACCTCATTCTCCCACGGG + Intronic
1181438088 22:22921922-22921944 GGGGGATCTGACTCTCCAGTGGG - Intergenic
1181547787 22:23612912-23612934 GGGGGACACAACTCTCTCACAGG - Intronic
1183928859 22:41224857-41224879 GAGGGACCTGGCTCTTCCCCTGG + Intronic
1184695686 22:46137645-46137667 GGGGCACCTGGCTCTGCCACTGG - Intergenic
950078914 3:10207371-10207393 TGGGGACCTGACCCTTCCAAAGG - Intronic
951079994 3:18443257-18443279 AGGGGACCTGACTTTCTCAAGGG - Intronic
954328941 3:49878823-49878845 GGAGGGCCTGACCCTACCACAGG - Intergenic
954994024 3:54865556-54865578 GGAGGCCCTCACTCTGCCACAGG + Intronic
955345251 3:58156222-58156244 TGGGGAGTTGACTCTGCCACAGG - Intronic
955391372 3:58524710-58524732 TGGTGACCTGGCTCTCCCACGGG - Intronic
955430651 3:58841178-58841200 GGGTGACCTGACTCTCAAACAGG + Intronic
961681631 3:128603726-128603748 GGGGGACATGCCACCCCCACAGG + Intergenic
966205496 3:177401923-177401945 AGGGGACATGACTCTTCCAAGGG + Intergenic
969138576 4:5050683-5050705 GGGGGACCTGCCTGTCCCTCAGG + Intergenic
972688224 4:41371468-41371490 TTGGAACCTGACTCCCCCACTGG + Intronic
975697874 4:77031648-77031670 GGGAGGCCTAAATCTCCCACTGG - Intronic
984875850 4:184366811-184366833 TGGGGACCTGCCTAGCCCACCGG - Intergenic
986620998 5:9674200-9674222 AGGGGACCTGACTCTCCAGTAGG - Intronic
992564517 5:77984775-77984797 GGGGGCCCTGCCTTTCCCGCTGG - Intergenic
998487023 5:142511835-142511857 GGAGGACCTGCCTTGCCCACAGG + Intergenic
999047351 5:148483250-148483272 GGTGACACTGACTCTCCCACTGG + Exonic
1001216744 5:169863619-169863641 GGGTGGCCTGACTCTGCCACAGG + Intronic
1006405521 6:33842700-33842722 AGGGGGCCTGACTCCCTCACTGG - Intergenic
1007170095 6:39856624-39856646 GGGGAACCAGAGTCTCTCACTGG + Intronic
1007407588 6:41643928-41643950 GGGGGACCTGACTCTCCCACAGG - Intronic
1015425084 6:133055839-133055861 GAGGTACCTGAATCTCCCACAGG + Intergenic
1020834251 7:13128466-13128488 GGTGAACCTGAATCACCCACTGG - Intergenic
1028177094 7:87672107-87672129 TGGCGACCTGCCTCTCCCTCTGG + Intronic
1034527998 7:151678281-151678303 GGGGGTCCTGCCACTCCCTCTGG + Intronic
1035430732 7:158818755-158818777 GTTGGACCTGACTCACCCAAGGG + Intronic
1043528264 8:81120213-81120235 GTGGGAGCTGACTCTCACTCCGG + Intergenic
1047700752 8:127447219-127447241 GGTGGACCTGGAACTCCCACTGG - Intergenic
1049346534 8:142142227-142142249 GGGGAGGCTGTCTCTCCCACCGG - Intergenic
1049788637 8:144462975-144462997 GGGGGCCCTCGCTCTCCCATTGG - Intronic
1051823287 9:21192509-21192531 TGGGGACCTGCCCCTCCCTCTGG - Intergenic
1051825107 9:21211045-21211067 TGGGGACCTGCCCCTCCCCCTGG - Intronic
1059299289 9:113299210-113299232 GGGGGACCTGAGTTCCCCCCAGG + Exonic
1060547202 9:124468497-124468519 GGGGATCCTGACCCTCCCACAGG + Exonic
1060807094 9:126584691-126584713 AGGGGCCCTGAGTCTCCCAGGGG + Intergenic
1061820952 9:133226929-133226951 GGTGGCCCTGAGTCTGCCACAGG + Intergenic
1187249727 X:17586057-17586079 GGGTGCTCTGACTCTACCACTGG - Intronic
1188960347 X:36483515-36483537 GGGGGATCTCACTCTCCTAGTGG + Intergenic
1191703118 X:64064340-64064362 TGGTGACCTGCCTCTCCCTCTGG - Intergenic
1192832654 X:74767097-74767119 GGGCAACCTGCCCCTCCCACTGG + Intronic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1200041778 X:153375943-153375965 GGCTGACTTGACTCTGCCACAGG - Intergenic
1201719619 Y:17082293-17082315 AGGGGACCTGTGTCTCTCACAGG - Intergenic