ID: 1007412523

View in Genome Browser
Species Human (GRCh38)
Location 6:41673314-41673336
Sequence CCTCAGGTACCTTAGCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007412523_1007412528 -10 Left 1007412523 6:41673314-41673336 CCTACCAGCTAAGGTACCTGAGG No data
Right 1007412528 6:41673327-41673349 GTACCTGAGGGGCGCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007412523 Original CRISPR CCTCAGGTACCTTAGCTGGT AGG (reversed) Intergenic
No off target data available for this crispr