ID: 1007413055

View in Genome Browser
Species Human (GRCh38)
Location 6:41675847-41675869
Sequence CTGAGTTCCTGCTCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007413055_1007413057 29 Left 1007413055 6:41675847-41675869 CCTGACACAGAGCAGGAACTCAG No data
Right 1007413057 6:41675899-41675921 GCCCTAATCCCTCTTCCTACAGG No data
1007413055_1007413056 2 Left 1007413055 6:41675847-41675869 CCTGACACAGAGCAGGAACTCAG No data
Right 1007413056 6:41675872-41675894 AACGAAACTACAGTCTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007413055 Original CRISPR CTGAGTTCCTGCTCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr