ID: 1007413830

View in Genome Browser
Species Human (GRCh38)
Location 6:41680440-41680462
Sequence GCCTCCTAAAAACTAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007413830_1007413832 -3 Left 1007413830 6:41680440-41680462 CCTGAGGTTAGTTTTTAGGAGGC No data
Right 1007413832 6:41680460-41680482 GGCTATGTGTGTGTTTGTCTGGG No data
1007413830_1007413831 -4 Left 1007413830 6:41680440-41680462 CCTGAGGTTAGTTTTTAGGAGGC No data
Right 1007413831 6:41680459-41680481 AGGCTATGTGTGTGTTTGTCTGG No data
1007413830_1007413833 -2 Left 1007413830 6:41680440-41680462 CCTGAGGTTAGTTTTTAGGAGGC No data
Right 1007413833 6:41680461-41680483 GCTATGTGTGTGTTTGTCTGGGG No data
1007413830_1007413834 4 Left 1007413830 6:41680440-41680462 CCTGAGGTTAGTTTTTAGGAGGC No data
Right 1007413834 6:41680467-41680489 TGTGTGTTTGTCTGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007413830 Original CRISPR GCCTCCTAAAAACTAACCTC AGG (reversed) Intergenic
No off target data available for this crispr