ID: 1007415938

View in Genome Browser
Species Human (GRCh38)
Location 6:41691237-41691259
Sequence TGTGGATGAGAAGGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 505}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007415932_1007415938 -8 Left 1007415932 6:41691222-41691244 CCGGCGCTGGCTCCCTGTGGATG 0: 1
1: 0
2: 2
3: 19
4: 226
Right 1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG 0: 1
1: 0
2: 2
3: 52
4: 505
1007415927_1007415938 17 Left 1007415927 6:41691197-41691219 CCTATGCGTGACGCCATGGTGGC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG 0: 1
1: 0
2: 2
3: 52
4: 505
1007415925_1007415938 18 Left 1007415925 6:41691196-41691218 CCCTATGCGTGACGCCATGGTGG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG 0: 1
1: 0
2: 2
3: 52
4: 505
1007415930_1007415938 4 Left 1007415930 6:41691210-41691232 CCATGGTGGCTGCCGGCGCTGGC 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG 0: 1
1: 0
2: 2
3: 52
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007415938 Original CRISPR TGTGGATGAGAAGGGGCAGC AGG Intronic
900462655 1:2808960-2808982 TGTGGAGGAGCTGGGGCTGCCGG + Intergenic
900557101 1:3286130-3286152 TGTGGATGAGGAGAGGGAGCTGG - Intronic
900695953 1:4010540-4010562 TGTGGTTCAGCAGGGGCGGCGGG + Intergenic
901718618 1:11176937-11176959 TGTAGAAGAGAAAGGACAGCAGG + Intronic
902134758 1:14295384-14295406 TGTGCATGAGAGGGAGAAGCTGG - Intergenic
902434291 1:16387564-16387586 TGGGGAAGTGAAGGGGCTGCAGG - Intronic
902546412 1:17193346-17193368 TGTGGAGGAGGAAGGGCTGCAGG + Intergenic
902583279 1:17422813-17422835 TCGAAATGAGAAGGGGCAGCTGG - Exonic
902756555 1:18552882-18552904 TGTGGAGGGGCAGGGACAGCTGG - Intergenic
903046281 1:20566505-20566527 TGGACAGGAGAAGGGGCAGCTGG - Intergenic
903270875 1:22187496-22187518 AGTGGAAGAGAAGGGGCTGGAGG - Intergenic
903377442 1:22875797-22875819 TGAGTATGAGAAGGGGCTACTGG + Intronic
903964808 1:27080767-27080789 TGTGATTGAGAAGGGGCACGTGG - Intergenic
904209831 1:28879666-28879688 AGTGGATGAGCAGGGGGAGGTGG + Intergenic
904795807 1:33055571-33055593 GGTAGATGTGATGGGGCAGCAGG - Intronic
904854377 1:33486016-33486038 TGTGGAAGAGCAGAGGGAGCTGG + Intronic
905005469 1:34706197-34706219 TTTGGCTGAGCAGGGGCAGCCGG - Intergenic
906222301 1:44090538-44090560 TGTGGAAGAGAAGAGGGGGCAGG + Intergenic
906616732 1:47238118-47238140 TGAGGATGTGAAGGAGCAACTGG + Intergenic
906902785 1:49854611-49854633 TGTGGAGGTGCAGGAGCAGCTGG - Intronic
906906433 1:49898983-49899005 TGTGGATGTGAAGAGGAAGTGGG + Intronic
907304317 1:53505395-53505417 TGTAGGTGAGGAGGGGCAGCCGG - Intergenic
907480628 1:54743476-54743498 TGGGGATGAAAAAGGGCTGCAGG - Intergenic
908032601 1:60017194-60017216 TCTGGAAGAGAAAAGGCAGCAGG + Intronic
908089208 1:60668897-60668919 GGTGGAAGAGTAGGGGCTGCCGG - Intergenic
909596709 1:77413863-77413885 TCTGGGTGAGAAGGGGAAGTGGG - Intronic
911758815 1:101592189-101592211 TGGGGAAGTGAAGAGGCAGCAGG - Intergenic
913328784 1:117650379-117650401 GGTGGATGGGAAGAGACAGCTGG + Intergenic
914232662 1:145778674-145778696 TGGGGATGGGAAGGGGCAGGAGG - Intronic
915086373 1:153391679-153391701 TGTGGAGGAGTGTGGGCAGCAGG - Intergenic
915086494 1:153392666-153392688 TGTGGAGGAGTGTGGGCAGCAGG - Intergenic
915212887 1:154323519-154323541 TTTGGATGAGAGAGGGCAGATGG + Intronic
915216871 1:154346281-154346303 TGTTGAAGAGAAGGTTCAGCTGG - Exonic
915583846 1:156832633-156832655 TATGGGTGTGAAGGGGCAGGAGG + Intronic
915937111 1:160096074-160096096 GAGAGATGAGAAGGGGCAGCTGG - Intronic
916603899 1:166322208-166322230 TTTGCATGAGTAGGGACAGCTGG - Intergenic
917164487 1:172097061-172097083 AGTGCAGGAGAAGGGGGAGCAGG + Intronic
918127460 1:181596960-181596982 TGTGGAGGAGAAGGGGCTGAGGG + Intronic
918131624 1:181634722-181634744 TGTGGATAATGAGGGGCAGAAGG - Intronic
918516431 1:185368869-185368891 TGTTGGTGAGTAGGGGGAGCTGG + Intergenic
919742664 1:200990239-200990261 CGAGGAAGAGAAGGGGCTGCAGG - Exonic
919976744 1:202617714-202617736 TGGGGATGAGAATGGAGAGCTGG - Intronic
921516035 1:216093392-216093414 TGTGAATGAGAAGGGTAAGGGGG + Intronic
921606763 1:217165234-217165256 TGTCCATGAGAAAGGGAAGCAGG - Intergenic
921801111 1:219403454-219403476 TGTGGAGGAGAGGGAGAAGCAGG + Intergenic
922016029 1:221648163-221648185 GGTGGGTGAGAAGGGGTAGCTGG + Intergenic
922055229 1:222036260-222036282 TGTGCATGTGTAGGGGAAGCAGG + Intergenic
922329542 1:224562274-224562296 TCTGGAGTAGAAGGGTCAGCAGG - Intronic
922984991 1:229859458-229859480 TGTGGACGAGAAGGTGCCGCAGG - Intergenic
923491136 1:234485206-234485228 TGAGGATGCGGAGGGGTAGCTGG - Intergenic
1063353024 10:5373843-5373865 TGAGGCTGAGAAGGGCCAGTGGG + Exonic
1064960679 10:20961604-20961626 TCTGGATGAGAAAGGGAGGCTGG - Intronic
1066057307 10:31694275-31694297 TGTGGGTGAGCAGGGCCAGATGG + Intergenic
1067337340 10:45376008-45376030 TGTGGAGGAGAATGGGGAGGAGG - Intronic
1067793199 10:49302848-49302870 TGTGGCTCAGAAGGGGCAACAGG + Intronic
1067842132 10:49689233-49689255 TGTGGAGGAGCAGGGGCAGAGGG + Intronic
1068953706 10:62804018-62804040 TTTGCCTGAGAAGGGGGAGCGGG - Intergenic
1070819512 10:79346771-79346793 TGCTGATGGGAGGGGGCAGCTGG + Intergenic
1070934286 10:80281374-80281396 TGTAGATGGGAAAGGGCAGGTGG - Intronic
1072001292 10:91198263-91198285 TGTGGTTGAGAATGAGCAGATGG - Intronic
1072459293 10:95604725-95604747 TGTCACTTAGAAGGGGCAGCTGG + Intergenic
1073155322 10:101341866-101341888 GGTGGATGAGAGCTGGCAGCTGG - Intergenic
1073476289 10:103756136-103756158 TGTGGAGGTGAAGGGGGAGGAGG + Intronic
1073732604 10:106307936-106307958 TGTGTCTGAGTATGGGCAGCAGG + Intergenic
1074290821 10:112137006-112137028 AGTGGGTGAGAAGGCTCAGCTGG - Intergenic
1075317684 10:121465816-121465838 TAAGGGTGAGAAGGGGCAGCGGG - Intergenic
1075347017 10:121690222-121690244 TGCGTAAGAGAAGGGGCAGGAGG + Intergenic
1075873162 10:125785946-125785968 TGGGGATCAGAAGGGACAGAAGG - Intronic
1076076013 10:127534438-127534460 TGTGGATGGGAAGGGGAGACGGG - Intergenic
1076228190 10:128797832-128797854 TCTGGAGAAGAGGGGGCAGCAGG + Intergenic
1076321597 10:129586347-129586369 TGGGGATGAGAAAGGAAAGCGGG - Intronic
1076788418 10:132763321-132763343 TGTGGAGGTGAGGAGGCAGCAGG - Intronic
1076839845 10:133040599-133040621 TGTGGGTGAGGTGGGGCAGGTGG + Intergenic
1077023628 11:430466-430488 TGGGGGTGGGAGGGGGCAGCAGG + Intronic
1077461721 11:2714171-2714193 TGTGGATGAGATGGAGACGCAGG - Intronic
1077769204 11:5196419-5196441 TGTGGAAGACAAGGTGCAGGAGG - Intergenic
1077798932 11:5518860-5518882 TGGTGATGAGAAGGGGCTGTGGG - Intronic
1078530244 11:12131381-12131403 GGAGGATGAGAAGGGGGAGCTGG - Intronic
1079150026 11:17890116-17890138 AGTGGCTAAGAAGGGGCAGCAGG + Intronic
1081717038 11:45257781-45257803 TGTGGATAAGAAGCTGCAGCAGG + Intronic
1081774035 11:45665660-45665682 TGGGGAGGAGAAGGGGCGGGCGG - Intergenic
1082072666 11:47951492-47951514 TGAGGATGAGAATAGGCAGGGGG - Intergenic
1083226935 11:61291236-61291258 TGGGGATGGGAAGGGGCTGATGG - Intronic
1083439939 11:62669488-62669510 TGTGGGAGAGAAAAGGCAGCTGG - Intronic
1083663694 11:64263737-64263759 TGTAGATGAGCAGGGCCGGCAGG - Exonic
1083680960 11:64351712-64351734 TGGGGAAGAGGTGGGGCAGCTGG - Intronic
1084045543 11:66565892-66565914 TGTGACTGAGAAGGCCCAGCAGG + Exonic
1084143556 11:67250571-67250593 TGGGGATGAGGAGGGGCTGGGGG + Exonic
1084696832 11:70760875-70760897 GGAGGATGAGAAGAGCCAGCAGG + Intronic
1085041670 11:73330571-73330593 TGTGGAGGGGCAGGGGCAGAGGG + Intronic
1085246659 11:75107457-75107479 TGGGGAGGAGAAAGGGCAGCTGG - Intronic
1086665053 11:89470207-89470229 TGTGGATGACAAGGGACACTAGG - Intronic
1086887969 11:92225530-92225552 GGTGGATGAGAAGGTTCAGGTGG + Intergenic
1088899220 11:114102554-114102576 TGCGGAAGGGCAGGGGCAGCCGG - Intronic
1089102635 11:115976439-115976461 GGTGGATGGGGAAGGGCAGCAGG + Intergenic
1089124254 11:116165104-116165126 GGTGAGTCAGAAGGGGCAGCTGG + Intergenic
1090358065 11:126153876-126153898 AGTAGATGTGAAGGGACAGCAGG - Intergenic
1090774050 11:129947588-129947610 TGTGGGACAGAAGGGGCAGAGGG - Intronic
1090994239 11:131850855-131850877 TGAGGAGAAGAAGAGGCAGCAGG + Intronic
1091768945 12:3139117-3139139 AGAGGATGCCAAGGGGCAGCGGG - Intronic
1092145565 12:6212324-6212346 TAAGAATCAGAAGGGGCAGCAGG + Intronic
1093136260 12:15455297-15455319 TGTGGGGGGGAAGGGGCAGTGGG - Intronic
1093401352 12:18750698-18750720 TGAGGATTAGAGGGGGCAACTGG - Intergenic
1094407655 12:30135127-30135149 TGTGGAGGAGAAGGGATAGGAGG - Intergenic
1095913581 12:47453771-47453793 TTTGGATGAGAAGTGTCAGCAGG + Intergenic
1096113964 12:49044322-49044344 TGTGGATGAGAAGCCGCTGGGGG + Intronic
1096157679 12:49349682-49349704 TCAGGATGAGAAGCGTCAGCTGG + Exonic
1096579122 12:52573205-52573227 TGTGGCTGGAAAGGTGCAGCTGG - Intronic
1096594879 12:52688621-52688643 TGGGGGTGAGAAGGAGCAGCTGG - Intergenic
1096758194 12:53817406-53817428 TGTGGGTGAGAAGAGGCAGAGGG + Intergenic
1098622069 12:72613751-72613773 TCTGGAAGAGAAGGAGCAGAAGG + Intronic
1101924604 12:108960824-108960846 AGGGGCTGAGATGGGGCAGCAGG - Intronic
1101941229 12:109100681-109100703 TGAGGATCAGATGGGCCAGCAGG + Intronic
1103567192 12:121822790-121822812 TGGGTAGGAGAAGGGGCTGCCGG - Exonic
1103598975 12:122042092-122042114 TGTGCCTGAGAAGGGGGTGCAGG + Intronic
1103796922 12:123509760-123509782 TGTGCATGAGGGTGGGCAGCAGG - Intronic
1104624373 12:130339243-130339265 TGTGGAGGGAAAGGGGCGGCGGG + Intronic
1105592865 13:21810734-21810756 TGTGGCTGAGAAAGGGGAGAGGG + Intergenic
1105752356 13:23433317-23433339 TGTGGGTGAGGAGCGGCTGCAGG - Intronic
1105775819 13:23659147-23659169 AGAGGATGAGCAGGGCCAGCAGG - Exonic
1106246390 13:27953911-27953933 GGAGGCTGAGCAGGGGCAGCCGG - Intergenic
1106717883 13:32409815-32409837 TGTAGGGGAGAAGGGGCTGCAGG + Intronic
1107354076 13:39547110-39547132 TGTGGAAGGAAAGGAGCAGCAGG - Intronic
1107382753 13:39875229-39875251 AGAGGATGACAAGGGGCCGCTGG - Intergenic
1108502600 13:51081769-51081791 TGTGTCTGAGAATGGGCACCAGG + Intergenic
1110702671 13:78567181-78567203 TGTGTATGAGAAGGAGCACTAGG + Intergenic
1113168034 13:107465649-107465671 TGTTGATGAGATGGGGCACTGGG + Intronic
1113507231 13:110825674-110825696 TGTGGATGAGAAGGAGCTTGAGG - Intergenic
1113859474 13:113471896-113471918 TGGTGATGAGCAGGGGCTGCTGG + Intronic
1114535879 14:23422142-23422164 TGGGGAGGAGGAAGGGCAGCAGG + Intronic
1114565796 14:23631878-23631900 TTTGCATGGGAAGGGGAAGCAGG + Intronic
1114673129 14:24423635-24423657 TGGGGAAGATGAGGGGCAGCTGG + Intergenic
1119845451 14:77826181-77826203 TGTGCCTGGGAAGGGGGAGCTGG + Intronic
1121110339 14:91308301-91308323 TGAGGCTGAGAATGGGCAGCTGG + Intronic
1121587452 14:95072046-95072068 TGCGGATGAGGATGGGGAGCGGG - Intergenic
1121712297 14:96047796-96047818 TGTGCATGAACAGGGGCAGAGGG - Intronic
1122174504 14:99907078-99907100 TGGGGAAGAGAAGGGCCAGTGGG - Intronic
1122189892 14:100033102-100033124 TGTGGATGGGAAAGATCAGCCGG + Intronic
1122257985 14:100493543-100493565 TGTGCATAAGAATGGGCAGAGGG - Intronic
1122268631 14:100558383-100558405 GGAGCCTGAGAAGGGGCAGCCGG - Intronic
1122435207 14:101690668-101690690 TGGGGAAGTGAAGGGGAAGCAGG + Intergenic
1122606241 14:102948684-102948706 TGTGGAGGTGAGGGGGGAGCAGG + Intronic
1122740630 14:103869793-103869815 TGTCCATGAAGAGGGGCAGCAGG - Intergenic
1123028557 14:105439905-105439927 TTGGGATCAGAGGGGGCAGCGGG + Intronic
1124492396 15:30166086-30166108 TGGGGATGAGAATGGAGAGCCGG - Intergenic
1124751139 15:32372231-32372253 TGGGGATGAGAATGGAGAGCCGG + Intergenic
1125721907 15:41849294-41849316 GGTGGATGTGCAGGGGCAGGAGG - Intronic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1126411907 15:48380807-48380829 TGAGGCTGAGAATGGACAGCAGG + Intergenic
1126419084 15:48452575-48452597 TGTGGAGGTGAAGCGGTAGCCGG + Exonic
1128320712 15:66691975-66691997 TGTGGATGGAAGGGGTCAGCTGG - Intergenic
1128324448 15:66714928-66714950 TTCAGATGAGAAGTGGCAGCAGG + Intronic
1128367968 15:67018189-67018211 TGTGGCTGAGAAGGAGCAGCTGG - Intergenic
1128498222 15:68210303-68210325 TGTGGGTGAGAAGAGGCAGGCGG - Intronic
1128530425 15:68441475-68441497 TGGGGATGAGCAGGAGCAGCTGG - Intergenic
1128738963 15:70070537-70070559 TGTGAAAGAGAAGGAGCAGTCGG - Intronic
1129786827 15:78315264-78315286 TGTGGATGGGAGTGGGCATCTGG - Intergenic
1130066103 15:80606264-80606286 TGTGGATGAAAATAGGCAGAGGG - Intergenic
1130794423 15:87193798-87193820 TGTGAATGAGAAGAGGAAACAGG - Intergenic
1131260301 15:90884397-90884419 TGTGGAGGGGAAGGGGCGGGCGG - Exonic
1131266617 15:90919261-90919283 TGTTGCTGAGAGGGGCCAGCCGG + Intronic
1131507186 15:93029301-93029323 TGGGGAGGAGAAGGTGCAGCTGG + Intergenic
1132549238 16:547530-547552 GGTGGACGAGAAGGGGCTGAAGG - Exonic
1132679697 16:1134619-1134641 GGAGGATGAGAAGGGGCTGGTGG + Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1135569143 16:23535008-23535030 TGTTGAGGAGCAGGGGCAGGTGG + Exonic
1137458119 16:48633834-48633856 TGAGGATGAGCAGGCACAGCAGG + Intergenic
1137609844 16:49810936-49810958 TGTGGCTAAGGAGGGGCATCAGG + Intronic
1137893855 16:52190130-52190152 GGTGGAAGAGAAGGGGAAGCAGG - Intergenic
1138300979 16:55929494-55929516 TGTGGATGTGGAGGCGCAGAGGG - Intronic
1138630188 16:58287702-58287724 AGTGGATCTGAAGGGGCAGGTGG + Intronic
1138911071 16:61399496-61399518 TTTGGAGGAGAAAGAGCAGCAGG - Intergenic
1138969578 16:62128695-62128717 GGAGGATGAGGAGGAGCAGCAGG - Intergenic
1139476278 16:67204083-67204105 GGTGGATAAGATGGGGCATCAGG + Intergenic
1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG + Exonic
1139846096 16:69922616-69922638 GGTAGAAGAGGAGGGGCAGCCGG + Intronic
1140401440 16:74675050-74675072 GGTGGCTGTGAAGCGGCAGCAGG - Exonic
1141595568 16:85095003-85095025 TGTGGCTAAGAGGGGGCAGATGG - Intergenic
1141652460 16:85400961-85400983 TGTGTGTGAGAGGAGGCAGCCGG + Intergenic
1141854154 16:86669741-86669763 TGGGGAGAAGAAGGGGTAGCTGG - Intergenic
1142718654 17:1762277-1762299 AGTGGATGAGAGAGGGCAGAGGG + Intronic
1143591040 17:7885803-7885825 TGCTGATGAGTAGGGGCAGGTGG + Intronic
1143712671 17:8745037-8745059 TGTGGCTGAGAAGGGGCATCGGG + Intronic
1143891452 17:10105610-10105632 TCTGGATGACAAGAAGCAGCTGG - Intronic
1147164917 17:38587923-38587945 TGTGAAAGAGGAGGGGCAGGGGG - Intronic
1147535155 17:41315965-41315987 TGGAGATGGGAAGGGGAAGCCGG + Intergenic
1147878109 17:43636020-43636042 TAGGACTGAGAAGGGGCAGCCGG + Intergenic
1147882417 17:43662718-43662740 GGGGGATGAGAAAGGGAAGCAGG - Intergenic
1148028558 17:44604892-44604914 TGTGGATTGGAAGGGACAGCTGG - Intergenic
1148078796 17:44955985-44956007 TGGGGACCAGAGGGGGCAGCGGG - Intergenic
1148322992 17:46768801-46768823 TGGGGGAGAGAAGTGGCAGCTGG + Intronic
1148806474 17:50266548-50266570 TGGGGATGAGATGGAGCAGGGGG - Intergenic
1149262995 17:54899896-54899918 TCTGGTTCTGAAGGGGCAGCTGG + Intronic
1149292211 17:55228177-55228199 TGTGCCTGAGAAAGGACAGCAGG - Intergenic
1150141957 17:62737719-62737741 CGTGGATGAGAAAGGGCTGGTGG - Intronic
1151517487 17:74605776-74605798 TGTGGGTGATATGAGGCAGCAGG + Intergenic
1152305319 17:79516967-79516989 TGGGGATGGGAATGGGGAGCCGG + Intergenic
1152573820 17:81131645-81131667 TCTGGATGGGCAGGGCCAGCTGG - Intronic
1152706692 17:81847254-81847276 ACTCGATGACAAGGGGCAGCTGG + Exonic
1153101579 18:1476383-1476405 TGTGGTTGAGAAGGTGCTTCTGG + Intergenic
1155698468 18:28713259-28713281 TATGGATGTGAAGATGCAGCTGG - Intergenic
1156508084 18:37611600-37611622 TTGGGATGAGGAGGGGCAGAAGG - Intergenic
1156510765 18:37634760-37634782 GGAGGATGAGAAGTGACAGCAGG - Intergenic
1157442063 18:47719017-47719039 TGTGGATGAGGAGTGGTAGGGGG - Intergenic
1158202684 18:54958284-54958306 TGGGGAAGAGAGTGGGCAGCGGG + Intronic
1159176604 18:64844123-64844145 TGTGGAAGACAGGGGACAGCTGG + Intergenic
1160720614 19:595520-595542 AGTGGCTGAAGAGGGGCAGCAGG - Intronic
1160731030 19:641885-641907 TGTGGGTGAGGAGTGGCGGCTGG + Intronic
1160895103 19:1398845-1398867 TGGGGGTGGGAAGGGGCTGCTGG - Exonic
1160944168 19:1633466-1633488 TGTGGATGAGCAGGGAGGGCAGG - Intronic
1161139982 19:2641490-2641512 TGTGGCTGTGAAGGGGGAGGAGG + Intronic
1161457489 19:4376829-4376851 TGTGTCTGAGACGGGACAGCAGG - Intronic
1161579142 19:5071112-5071134 TGTGGGTGGGGAAGGGCAGCTGG + Intronic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162137499 19:8564699-8564721 TCTGGCTGAGAAGGGGAAGAGGG + Intronic
1162231441 19:9270445-9270467 TGCAGCAGAGAAGGGGCAGCTGG + Intergenic
1162740998 19:12773658-12773680 AGTGGAAGAGGAGAGGCAGCTGG - Intronic
1163103523 19:15110678-15110700 TCTGGATGATGAGGGGCACCTGG - Exonic
1163525024 19:17815609-17815631 CCTGGATGAGATGGGGCTGCAGG + Intergenic
1163686949 19:18717219-18717241 TGGGGCTGAGAGGGGGCTGCTGG + Intronic
1164519168 19:28964645-28964667 TGTGGCTATGAAAGGGCAGCAGG + Intergenic
1164629201 19:29750657-29750679 GGTGGGTGAGAAGGACCAGCTGG - Intergenic
1165075661 19:33278752-33278774 TGGGGAGGAGCAGGGGCTGCAGG - Intergenic
1165123308 19:33577396-33577418 CGTAGATTAGAAGGGGCAGCCGG - Intergenic
1166196182 19:41207331-41207353 TGTGTGTGTGGAGGGGCAGCAGG - Exonic
1166627428 19:44371729-44371751 TGAGGAGGAAAAGTGGCAGCCGG - Intronic
1166806172 19:45488688-45488710 TGTAGAAGAGGAGGGCCAGCTGG + Exonic
1167077937 19:47260451-47260473 TGAGGATGGGGAGGGGCAGAGGG + Intronic
1167492081 19:49798806-49798828 TGCGGCTGTGAAGGGGCGGCTGG + Exonic
1167571903 19:50293573-50293595 TCTGGAGGAGAAGCGTCAGCTGG + Exonic
1167693596 19:51001715-51001737 TGTGAGTGAGAAGGGGCGGAGGG + Intronic
1167804700 19:51772875-51772897 TGTGCATGTGTAGGGGCAGTGGG - Intronic
1168466442 19:56605765-56605787 TCTGGAAGAGAAGCGCCAGCTGG + Intronic
925266864 2:2571735-2571757 TGGGGAGGAAGAGGGGCAGCAGG - Intergenic
925268736 2:2586634-2586656 TGGAGGTGAGAAGGGGCAGCTGG - Intergenic
925584070 2:5445223-5445245 TGTGTATGGAAAGAGGCAGCAGG + Intergenic
925611317 2:5705612-5705634 GGTGGAGGAGCAGGGGAAGCAGG + Intergenic
925934921 2:8747224-8747246 TGTGGGTGAAAAGGGGAAGGGGG + Intronic
927443260 2:23135031-23135053 TTTGGATTTGCAGGGGCAGCAGG + Intergenic
928171084 2:29003383-29003405 TGTGGCTGAAAAGAGACAGCAGG + Intronic
928793828 2:34992043-34992065 TGTGGAGGAAAAGGCGCAGGCGG + Intergenic
930027551 2:47038617-47038639 GGTGGGTGGGAAGTGGCAGCAGG - Intronic
931116936 2:59175084-59175106 TCTGGAGGAGCAGCGGCAGCGGG - Intergenic
932735734 2:74252950-74252972 TGTGTATGAGAATGGGCAGTAGG - Intronic
933901979 2:86856545-86856567 TGAGGAAGTGCAGGGGCAGCTGG - Intronic
934685207 2:96316215-96316237 TGTGGATGAGGAGGGGGTGGAGG - Intergenic
934921350 2:98347289-98347311 GATGGAGGAGAAGGGGCGGCGGG + Intronic
935778568 2:106492727-106492749 TGAGGAAGTGCAGGGGCAGCTGG + Intergenic
937122855 2:119452780-119452802 TGGGGAAGAGGAGAGGCAGCAGG - Intronic
938116949 2:128608625-128608647 TAAGGATGATAAGGGGCAGTTGG + Intergenic
938546076 2:132332832-132332854 TGAGGAGGAAAAGTGGCAGCCGG + Intergenic
939420271 2:141958246-141958268 GGTGCATTAGAAGAGGCAGCTGG + Intronic
939651284 2:144765618-144765640 TGTGGGTGGGAGGGAGCAGCTGG + Intergenic
940258529 2:151757506-151757528 TGTGGAAGATAATGGGGAGCTGG - Intergenic
941517130 2:166493864-166493886 TGTGTATGGGATGGGGCAGGTGG + Intronic
942326807 2:174782730-174782752 CTTGGATAAGAAGGGGCACCAGG + Intergenic
942512508 2:176717524-176717546 TGTGAAGGAGCAAGGGCAGCAGG + Intergenic
942585402 2:177470212-177470234 TGTGGAGTAGAACAGGCAGCAGG + Intronic
942655911 2:178213886-178213908 TGAAGATGAGAAGGGCAAGCAGG - Intronic
944185173 2:196940306-196940328 TATGGATGAGAATGGGTAACAGG - Intergenic
945312082 2:208325613-208325635 TGTGTTTGAGAAGGGTGAGCAGG + Exonic
945973749 2:216254610-216254632 TGTGGAGGTGAGAGGGCAGCGGG - Intergenic
945976803 2:216277493-216277515 GGTGGATGGGAAGGGGGAGGAGG - Intronic
946536747 2:220638368-220638390 TGGGGAAGAGAAGAGGCAGGAGG + Intergenic
946713066 2:222525896-222525918 TGTGGGAGAGAGGGGGCAGAAGG + Intronic
947124570 2:226853894-226853916 TGTGCTTTAGAATGGGCAGCTGG + Intronic
947726941 2:232406976-232406998 TGTGTGTGTGTAGGGGCAGCTGG - Intronic
948284754 2:236774718-236774740 TGGGGGTGATAAGGGGCAGAGGG + Intergenic
948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG + Intronic
948534644 2:238636906-238636928 TGTGGCTGAGAAGGGACAAATGG + Intergenic
948907953 2:240988783-240988805 GGGGGCTGAGAAGGAGCAGCTGG + Intronic
949037270 2:241821623-241821645 GGTGGAAGAGAAGGGGGAGCAGG - Intergenic
1169487012 20:6042189-6042211 GGAGGCTGAGAAGGGGCCGCTGG + Exonic
1169811709 20:9615406-9615428 TGTGCATGTGTAGGGGCAGGGGG + Intronic
1170733823 20:18996377-18996399 TTTGGAAGAGAAGGGGGAGGGGG + Intergenic
1170893601 20:20395682-20395704 AGGGGAAGAGAAAGGGCAGCTGG + Intronic
1171874939 20:30565565-30565587 TGAGGAGGAAAAGTGGCAGCCGG + Intergenic
1172002284 20:31788603-31788625 TGTGGTTGATAAGTGGCAGGGGG + Intronic
1172090134 20:32424946-32424968 TGTGACTGGGAAGGGGCAGTGGG - Intronic
1172186493 20:33034296-33034318 TGTGGCAGGGGAGGGGCAGCGGG + Intronic
1172413082 20:34740980-34741002 GGGGGATGAGAAGGGACAACTGG + Exonic
1172601819 20:36189312-36189334 TGTGGATGGGAAGGGGGAGTGGG - Intronic
1172821506 20:37738923-37738945 TGTGGATGAGAAGGCAGAGTGGG + Intronic
1173070572 20:39760734-39760756 TGTGTATGTGCAGGGGCAGTGGG + Intergenic
1173785406 20:45789530-45789552 TGTGTATGAGGAGGGGAAGGTGG - Intronic
1174506420 20:51020602-51020624 TGTGGGTGAAAAATGGCAGCTGG - Intronic
1174578681 20:51555650-51555672 GCTGGATCAGAAGGGGCAGGGGG - Intronic
1174720262 20:52804036-52804058 TGAGAATGAGAAGCAGCAGCCGG + Intergenic
1175508401 20:59503917-59503939 AGTGGATGAGAAGGAGAAGAGGG - Intergenic
1176080520 20:63270527-63270549 TGTGGATGCTGTGGGGCAGCAGG + Intronic
1177590261 21:23154856-23154878 TCTGAATCAGAAGAGGCAGCAGG + Intergenic
1178320988 21:31605551-31605573 AGTGGATGCAAAGGGGGAGCAGG - Intergenic
1178617927 21:34150037-34150059 TGTGCATGAGAAGAGGAGGCAGG - Intergenic
1180594805 22:16966121-16966143 TGCGGTTGACAGGGGGCAGCTGG + Exonic
1180800224 22:18628275-18628297 TGAGGCTGAGCAGGGGGAGCCGG + Intergenic
1180851457 22:19023839-19023861 TGAGGCTGAGCAGGGGGAGCTGG + Intergenic
1180951271 22:19721678-19721700 GGTGGAGGCCAAGGGGCAGCGGG + Exonic
1181221492 22:21366991-21367013 TGAGGCTGAGCAGGGGGAGCCGG - Intergenic
1181738110 22:24897983-24898005 TGTGGATGAGGTGGAGCAGGTGG + Exonic
1181765193 22:25086631-25086653 GGTGGATGGGACGGGGCAGATGG - Intronic
1182122096 22:27794886-27794908 GGAGGATGAGAAGGGGAAGGGGG + Intronic
1182246446 22:28961661-28961683 TGTGAATTAGAAAGGGCAGATGG + Intronic
1182716924 22:32364394-32364416 TGTGGCTAAGAATGGGCAGCAGG + Intronic
1182772359 22:32804617-32804639 TGTGGATGAGCAGAGACAGGAGG - Intronic
1183051295 22:35263876-35263898 TGAGGATGGGAATGGGCAACAGG + Intronic
1183498069 22:38161778-38161800 CGTGGAGGGGAAGGGGCTGCAGG + Intronic
1183519017 22:38285519-38285541 TGTGGAAGGGAAGGGGCATGAGG + Intergenic
1184171027 22:42759901-42759923 TGTGGATGAGGGGGTGGAGCAGG - Intergenic
1184253609 22:43274848-43274870 TGTGCATGAGGGGCGGCAGCGGG + Intronic
1184477329 22:44728825-44728847 GGAGGCTGAGAAGGGGCAGGGGG - Intronic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1184582902 22:45429277-45429299 AGTGGGTGAGAAGGTGAAGCCGG + Intronic
1184773725 22:46612919-46612941 TGTGGGTGAGCAGGGGCTGTGGG - Intronic
1184858496 22:47160133-47160155 TGTGAAGGAGAAGGAGCGGCGGG - Intronic
1185016677 22:48347338-48347360 TTTGGCAGGGAAGGGGCAGCCGG - Intergenic
949285938 3:2404531-2404553 TGTGGAGGAGAAGGTGAGGCAGG - Intronic
949465284 3:4337356-4337378 TGAGGATGAGGCTGGGCAGCTGG - Intronic
950039576 3:9911329-9911351 TGAGGATGAAATGGGGCAGGGGG - Intronic
950072205 3:10161701-10161723 TGCGGAAGAGAAGGAGAAGCAGG + Intergenic
950465423 3:13150565-13150587 TGGGGAAGAGTCGGGGCAGCAGG + Intergenic
950526314 3:13526324-13526346 TGAGGATGGGAAGGGACGGCTGG + Intergenic
950543953 3:13627965-13627987 TGTGGGTGAGCGGGGGCTGCAGG + Exonic
950575951 3:13832151-13832173 TGAGGAGGAGGAGGGGGAGCAGG - Intronic
952143236 3:30502460-30502482 TGTGAAGGAGAAGAGGCTGCTGG - Intergenic
952341166 3:32448823-32448845 TGTGGATGTGTGGTGGCAGCTGG - Intronic
952683993 3:36129327-36129349 TGTGGGTGTGAAGAGGCTGCTGG + Intergenic
952856775 3:37778226-37778248 TGTGGATGGGATGGGGCATGAGG + Intronic
953032331 3:39186907-39186929 TGTGGACCAGCAGGGGCTGCTGG - Exonic
953876952 3:46671900-46671922 CGTAGATGAGAAGTGGCAGCAGG + Exonic
953920143 3:46946148-46946170 TGTGGGTGGGAAGGGGCAAGAGG - Intronic
954395332 3:50290440-50290462 CGTGGATGAGCAGGGCCAGCAGG - Exonic
954577310 3:51683742-51683764 AGTGGCTGAGGAGGGGCTGCAGG - Intronic
954864214 3:53715236-53715258 TGAGGATGAGCAGAGGCAGACGG - Intronic
955402098 3:58599565-58599587 AGTGGATGGGAAGGGGCAGGAGG + Intronic
955510982 3:59679945-59679967 TGAGGCTCAGCAGGGGCAGCAGG - Intergenic
955911345 3:63863128-63863150 TGTGGGTGAGAAGGAGGAGCAGG - Intronic
956589819 3:70902746-70902768 TGTGGCTAAGAAAGGGCAACAGG + Intergenic
956760884 3:72443520-72443542 TGTGGAGGTTCAGGGGCAGCAGG - Intronic
957966829 3:87332930-87332952 TGTGGATGAGTAGGGGCCTACGG + Intergenic
960588490 3:119343576-119343598 TGTGGATGGGCTGGGGCAGGGGG - Intronic
961091071 3:124113355-124113377 TTTGGATGAGAAGGGGATGGTGG + Intronic
961194803 3:124992585-124992607 TGGGGGTGAGGAGGGGCAGGGGG + Intronic
961241727 3:125417222-125417244 TCTTGAGGGGAAGGGGCAGCTGG - Intergenic
961417151 3:126767433-126767455 TAGGAATGAGAAAGGGCAGCTGG - Intronic
962029896 3:131588845-131588867 TGCAGATGAGAAGGAGCAGTAGG - Intronic
962392574 3:134984972-134984994 TGTGGATGAGTGGGAGAAGCTGG + Intronic
963121952 3:141783840-141783862 TGTGGGTGGGAAGGAGGAGCAGG + Intronic
964634673 3:158845986-158846008 TGGGGTTGAGGCGGGGCAGCAGG - Intergenic
965288693 3:166849034-166849056 TTTGGATGAGAAGAGGCACTTGG + Intergenic
968054186 3:195678579-195678601 TGTGGAGGAGAGGGAGCCGCAGG + Intergenic
968289096 3:197525170-197525192 TGTGGAAGAGAGGGGTCTGCAGG - Intronic
969150664 4:5166239-5166261 TGTGGGTGAAAAGTGACAGCTGG + Intronic
969307611 4:6334871-6334893 TGTGGCTGAGAGGGGCCAGCAGG - Intronic
969415373 4:7054262-7054284 TGTGGCTGAGCAGCAGCAGCTGG + Exonic
969593413 4:8134410-8134432 TGTGGAGAGGGAGGGGCAGCAGG - Intronic
970242101 4:14020212-14020234 TGTGCATGAGGAGGGGAACCAGG - Intergenic
970488060 4:16544316-16544338 TGTGTCTGAGAAAGAGCAGCTGG + Intronic
970715460 4:18916781-18916803 GGTGGAGGTGAAGGGGGAGCAGG - Intergenic
971007430 4:22390979-22391001 TGTGTTTGACAAGGAGCAGCAGG - Intronic
971195168 4:24466395-24466417 TGGGGATAAGAAGAGGAAGCTGG + Intergenic
971418302 4:26453472-26453494 TGGGCAGGAGCAGGGGCAGCAGG + Intergenic
971507782 4:27385235-27385257 TATGCATGGGAAAGGGCAGCAGG - Intergenic
972338292 4:38128326-38128348 TCTGGATGGGAGGGGGCAGTAGG - Intronic
979123032 4:116926847-116926869 TGTGGATGGAAAGGGCGAGCTGG + Intergenic
980981521 4:139658430-139658452 TGAGGCTGAGATGGGGCAACAGG - Intergenic
982774146 4:159425084-159425106 TATGACTGAGAAGGAGCAGCCGG + Intergenic
983434037 4:167688769-167688791 TGTGGCTGAGAAGGGGAAGGAGG - Intergenic
983650122 4:170028636-170028658 TGTGGATGTCAAGGGGTACCTGG - Intronic
985149401 4:186930495-186930517 TGAGGATGAGAAGGAGAAGAAGG - Intergenic
985706139 5:1402402-1402424 TTTGGCTGAACAGGGGCAGCTGG - Intronic
986334193 5:6741009-6741031 TGTGTGTGCCAAGGGGCAGCGGG + Intronic
987084812 5:14458471-14458493 TAGGGTTGAGAAGGGGCAACAGG - Intronic
987149755 5:15026949-15026971 TGTAGAAGTGATGGGGCAGCTGG - Intergenic
987405252 5:17518193-17518215 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987405697 5:17521627-17521649 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987406144 5:17525061-17525083 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987406591 5:17528495-17528517 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987407105 5:17582476-17582498 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987407555 5:17585910-17585932 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987407806 5:17587675-17587697 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987408253 5:17591112-17591134 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987408701 5:17594546-17594568 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987409157 5:17597980-17598002 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987409272 5:17598711-17598733 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
990591498 5:57269946-57269968 TTTGGAGGAGAAAGGGAAGCAGG - Intergenic
991120525 5:63008323-63008345 TGCGGGTGAGCAGAGGCAGCCGG - Intergenic
991249794 5:64546912-64546934 GGTTGATGAGAAGGGGCATGAGG - Intronic
992018288 5:72597541-72597563 TGTGGGTGAGAAGGAGCACAGGG + Intergenic
992361386 5:76041954-76041976 TGTGGGTGAGAAGGCAAAGCAGG - Intergenic
992501627 5:77349240-77349262 TGGGGATGGAAAGGGGCAGCAGG + Intronic
992546899 5:77822192-77822214 TATGGGTGAGAAGGGTCATCTGG - Intronic
993021130 5:82592442-82592464 TGAGGATGAGAAGGAGGAGAAGG - Intergenic
993479193 5:88401856-88401878 TGTGGAAGTAAAGGGGCAGAGGG - Intergenic
993751184 5:91670582-91670604 TGTGGATTAGAGAGGCCAGCTGG - Intergenic
993803892 5:92379514-92379536 AGAGGATGAGAAAGGGAAGCAGG + Intergenic
994212133 5:97099141-97099163 TGTGGAGGAGAGGGGCCAGGAGG - Intronic
997631690 5:135373610-135373632 GGTGGATAAGGAGGGGCAGAAGG + Intronic
997694344 5:135849737-135849759 TGGGGAACAGCAGGGGCAGCTGG + Intronic
998549686 5:143065412-143065434 TGTGGCTGAAACGTGGCAGCTGG + Intronic
999117062 5:149173523-149173545 AGTGGATGAGATGGGGCAGAAGG + Intronic
999581248 5:153040692-153040714 TGTGCACAAGAAAGGGCAGCAGG + Intergenic
999591953 5:153157962-153157984 TGTATATGAGAAGTGGCAGATGG + Intergenic
999852091 5:155552372-155552394 TGTGGATGATCAGAGGCACCTGG - Intergenic
1000149361 5:158484642-158484664 TGTGATTGAGAAGGGGAACCAGG - Intergenic
1002135963 5:177107813-177107835 AGAGGATGAGAAGGGGTTGCCGG - Intergenic
1002665073 5:180817083-180817105 TGTGGAAGGGGAGGGGCGGCAGG + Intergenic
1002924844 6:1599363-1599385 TGGGGAGGAGAAGGGACAGAGGG - Intergenic
1003339459 6:5205743-5205765 TGAGGTGGAGAAGGGGGAGCTGG - Intronic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1003988391 6:11461039-11461061 TTTTAATGAGAAGGGGAAGCAGG - Intergenic
1004009868 6:11673703-11673725 TGAGGATGAGAAGATGCAGAAGG - Intergenic
1004310449 6:14540551-14540573 TGTGGGTGAGAAGGCTCAGGAGG + Intergenic
1005170732 6:22981384-22981406 TTTGGAGGAGAAGGGGCACTCGG - Intergenic
1006108209 6:31729149-31729171 TGTGGATGGGATGGGGACGCCGG - Exonic
1006829836 6:36961986-36962008 GGTGGATGGGTAGGGGCAGGGGG + Intronic
1007218480 6:40260004-40260026 TGTGGATGTGAAGGCTCAGATGG + Intergenic
1007359348 6:41343968-41343990 TGTGGCTGAGCAAGGGCAGAGGG - Intronic
1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG + Intronic
1007598326 6:43065722-43065744 GGAGGGTGAAAAGGGGCAGCAGG + Intronic
1007727890 6:43927686-43927708 TGAGGATGCGGAGGGGGAGCTGG - Intergenic
1008077123 6:47156605-47156627 TGTGGAAGAGGAGAGGAAGCAGG + Intergenic
1008491112 6:52088240-52088262 TGTGAATCAGAATGGGCAGTGGG - Intergenic
1008886139 6:56432942-56432964 TCGAAATGAGAAGGGGCAGCTGG - Intergenic
1009332125 6:62436728-62436750 TGTGGAAGAGAGGGGGCTGAGGG - Intergenic
1009518860 6:64656739-64656761 GGAGGATGAGAAGGGGAAGGGGG + Intronic
1009685832 6:66955690-66955712 GGTGGAGGTGAAGGGGAAGCAGG + Intergenic
1010191573 6:73201951-73201973 TGGGGAAGGGGAGGGGCAGCAGG - Intergenic
1011318793 6:86066243-86066265 AGTGGAGGAGAAGGGGTGGCTGG - Intergenic
1011694912 6:89903625-89903647 GGTGGAAGGGAAGGGGGAGCAGG + Intergenic
1012981003 6:105830884-105830906 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981011 6:105830905-105830927 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981019 6:105830926-105830948 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981035 6:105830967-105830989 GGAGGAGGGGAAGGGGCAGCGGG + Intergenic
1012981041 6:105830988-105831010 GGAGGAGGAGAAGGGGCAGCTGG + Intergenic
1012981049 6:105831009-105831031 GGAGGAGGGGAAGGGGCAGCCGG + Intergenic
1012981057 6:105831030-105831052 GGAGGAGGAGAAGGGGCAGGTGG + Intergenic
1012981118 6:105831184-105831206 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981132 6:105831227-105831249 GGAGGAGGAGAAGGGACAGCTGG + Intergenic
1012981140 6:105831248-105831270 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1013235571 6:108195230-108195252 TCTGGCTGAGGAGGGGCAGTGGG + Intergenic
1013313986 6:108923930-108923952 AGTGAATGAGAAGGGGAAGGAGG - Intronic
1013588732 6:111602597-111602619 TGGGTATGAGAAGGGGCAGTTGG + Intronic
1013851650 6:114523249-114523271 TGTGGGTGGGAGGGGGCAGCGGG + Intergenic
1014103379 6:117536563-117536585 TCTGGATGACAAGGTACAGCTGG - Intronic
1014383027 6:120767713-120767735 TGTGGATAAGAAGAGGAAGCGGG + Intergenic
1015890022 6:137961046-137961068 GGTGGAGGTGAAGGGGAAGCAGG - Intergenic
1016916386 6:149247905-149247927 TGTTGAGGGGTAGGGGCAGCGGG + Intronic
1017042790 6:150321339-150321361 TGTTGATGAGGAGGGGGAGGAGG - Intergenic
1018391576 6:163345395-163345417 TGTGGCTGAGGAGGGACACCTGG - Intergenic
1018447879 6:163874769-163874791 TGTGGATGGAAAGGGGCACAGGG - Intergenic
1018471566 6:164101811-164101833 TGTGGAGGAGAAGAGCCTGCAGG - Intergenic
1018797274 6:167196276-167196298 TGTGGGTGAGAGAGGGCAGGTGG - Intronic
1018819023 6:167358488-167358510 TGTGGGTGAGAGAGGGCAGGTGG + Intronic
1018902219 6:168057366-168057388 TGGGAGTGAGAGGGGGCAGCAGG - Intronic
1020260614 7:6528843-6528865 GGTGGATGGGAATGGGCACCGGG - Intronic
1020590798 7:10134175-10134197 GGTGGAAGACAAGGGGAAGCAGG - Intergenic
1020842998 7:13244178-13244200 TCTGGAAGAGAAGGGGCTTCTGG + Intergenic
1020983509 7:15102448-15102470 TGTGTGTGTGAAGGGGCAGGTGG - Intergenic
1021390730 7:20089546-20089568 TTTGGAGGAGAAGAGGCATCTGG - Intergenic
1022419312 7:30205853-30205875 TGGGGATGAGAAGGGGGCGAGGG - Intergenic
1022495346 7:30849832-30849854 TGTGGCTGGGAAGAGGTAGCTGG - Intronic
1022525221 7:31032790-31032812 TTTGGCTGAGATGGGGAAGCTGG + Intergenic
1022607611 7:31831700-31831722 GGAGGAGGAGAAGGGGCAGACGG + Intronic
1023086816 7:36579211-36579233 TGTGCCTGGGAAGGGACAGCTGG - Intronic
1023931380 7:44708511-44708533 TGAGGATGACCCGGGGCAGCTGG + Exonic
1024243957 7:47455506-47455528 TGTGGATATGAAAGGGAAGCAGG - Intronic
1024299519 7:47876531-47876553 TGTGGAAGCTGAGGGGCAGCTGG - Intronic
1025004281 7:55342905-55342927 TGTGGACAAGAAGGGCCTGCAGG + Intergenic
1026425815 7:70292300-70292322 TTTAGATGAGAATGTGCAGCAGG - Intronic
1026620399 7:71945163-71945185 GGTGGAAGGGAAGGGGGAGCAGG - Intronic
1027216689 7:76188368-76188390 TGTGGAAGAGATGGGGCCTCGGG + Intergenic
1027528381 7:79299930-79299952 TGTGGAAGGCAAGGGGGAGCAGG - Intronic
1027610523 7:80354307-80354329 TGTGGCTGTGATGGAGCAGCAGG + Intergenic
1029975735 7:104831531-104831553 TCTGGAGGAGAGGGGGCTGCAGG - Intronic
1031063540 7:117078270-117078292 TGATGTTGAGAAGGTGCAGCTGG + Intronic
1032446903 7:131992009-131992031 AGTGGATGAGTAAGGGCAGAGGG + Intergenic
1033213998 7:139481080-139481102 TGAGCATCAGAAGTGGCAGCAGG + Intronic
1033602753 7:142900083-142900105 GGTGGAGGAGAAGGGGCAGGAGG - Intergenic
1033731803 7:144187675-144187697 TCTGGAGGAGCAGGGACAGCAGG - Exonic
1033742651 7:144286258-144286280 TCTGGAGGAGCAGGGACAGCAGG - Intergenic
1033751251 7:144363356-144363378 TCTGGAGGAGCAGGGACAGCAGG + Exonic
1033887634 7:145967622-145967644 TTTGGAGGAGAAGGGGCACTTGG - Intergenic
1034095195 7:148401123-148401145 CGTGGATGTGGAGGGCCAGCTGG + Intronic
1034265359 7:149777993-149778015 TGTGTCTGTGAAGGGGCAGCTGG + Intergenic
1034898100 7:154890407-154890429 TGTGGATGAAGAGGGGCAGAAGG + Intronic
1035675292 8:1451672-1451694 GATGGCTGAGAAGGGGCTGCTGG - Intergenic
1036772954 8:11591683-11591705 TGGAGATGAGCAGGGGCAGAAGG + Intergenic
1037374336 8:18211684-18211706 TCTGGATGAAAAGGGGTTGCTGG - Intronic
1037883601 8:22585096-22585118 TGGTGGTGAGAAGGGGCTGCCGG - Exonic
1038313288 8:26462282-26462304 TGGGTATGAGAAGGGGGAGAAGG + Intronic
1039039678 8:33395361-33395383 TGGAGAGGAGAAGAGGCAGCTGG + Intronic
1042673105 8:71285999-71286021 TGTGGATCAGAAGGGGAAAATGG + Intronic
1043329536 8:79097975-79097997 TGAGACTGAGGAGGGGCAGCTGG + Intergenic
1044287219 8:90422898-90422920 TGTGGAGGAGAAGGTGAAGCAGG - Intergenic
1046201559 8:110934445-110934467 TGTGCATGAGCAGGGATAGCAGG - Intergenic
1047037184 8:120952990-120953012 AGTGGATCAGAGAGGGCAGCAGG - Intergenic
1048056033 8:130866377-130866399 TGAGGGTGAGAAGGGGCCCCAGG - Intronic
1048512307 8:135073771-135073793 TGGGGCTGAGAAGGGGCTGCAGG - Intergenic
1048802327 8:138206017-138206039 TGTGTATGTGAAGGGGATGCTGG - Intronic
1048916696 8:139190861-139190883 TGTGCATGTGTAGGGGCAGAGGG + Intergenic
1049227807 8:141466063-141466085 TGTAGATGAGAAGAGACAGAGGG + Intergenic
1049594901 8:143478804-143478826 TGAGAATGAGCAGGGGCGGCTGG - Intronic
1049692177 8:143966247-143966269 TGCCTATGAGAAGAGGCAGCCGG - Intronic
1051582863 9:18695959-18695981 GATGGAAGAGAAGGGGAAGCAGG + Intronic
1053002816 9:34586580-34586602 TGTGGTAGAGAAGGGCCAGGTGG - Intronic
1053103037 9:35387378-35387400 TGGGAATGAGAAGAGGCAGTAGG - Intronic
1054751520 9:68912064-68912086 CTTGAATGAGTAGGGGCAGCTGG - Intronic
1054831464 9:69630098-69630120 TATGTATGTGAAGGGGCAGTGGG + Intronic
1054842316 9:69756571-69756593 TGTGGCTGAGAAGGTACAGTAGG - Intronic
1055056058 9:72025254-72025276 TTTGCATGAGAAGGGACAACAGG - Intergenic
1056342407 9:85650340-85650362 TGAGGAGGAGGAGGGGCAGGAGG - Intronic
1056396372 9:86185199-86185221 TGTGGATGAGTATGGGGAGAAGG + Intergenic
1056784680 9:89581948-89581970 TGGGGCTGAGAAAGGGGAGCTGG + Intergenic
1056844892 9:90029119-90029141 TGTGGATGTGTGGGGGCAGAGGG + Intergenic
1057247507 9:93469163-93469185 CCTGGGTGAGAAGGGGCTGCTGG - Intronic
1057318802 9:93992645-93992667 TCTGGAGGAGAAGGGACAGGAGG - Intergenic
1057434265 9:95024767-95024789 TGTGGAAGAGTAGAGGAAGCAGG - Intronic
1058263163 9:102862355-102862377 TGTGGAAGTGAAGGGGCATTTGG - Intergenic
1058601787 9:106678417-106678439 TGTGGATGACAAGAGGGAGCAGG - Intergenic
1058940747 9:109810586-109810608 TGAGAATGAGATGAGGCAGCAGG + Intronic
1059428795 9:114237638-114237660 TGTGGAAGAGAAGAGGTTGCAGG - Intronic
1059453220 9:114383724-114383746 TGTGGCTGAGAAAAGTCAGCAGG + Intronic
1060739066 9:126086024-126086046 GGAGGCAGAGAAGGGGCAGCTGG + Intergenic
1060897220 9:127225458-127225480 TGGCGATGTGAAGGGACAGCGGG + Intronic
1061073874 9:128328850-128328872 TGTGGAGGGGAGGGGGTAGCAGG + Intronic
1061216276 9:129223834-129223856 TGTAGAGGAGAGAGGGCAGCTGG - Intergenic
1061521490 9:131120839-131120861 TGGGGATCAGCTGGGGCAGCGGG - Exonic
1061881877 9:133572830-133572852 AGTGGATGGGACTGGGCAGCTGG - Intronic
1061967599 9:134025117-134025139 AGTGGAGGAGAAGGAGGAGCAGG - Intergenic
1062027598 9:134347668-134347690 TGTGCATGGGAAGGAGCAGCCGG + Intronic
1062182846 9:135200060-135200082 TGGGGAGGAGAATGTGCAGCTGG + Intergenic
1062253707 9:135611049-135611071 TGTGGGTGAGCGTGGGCAGCAGG + Intergenic
1062429346 9:136520080-136520102 TGTGGAGGAGGAGGGGGAGGAGG - Intronic
1062549638 9:137080053-137080075 TGTGGATGAGGAGGGGAATCTGG + Exonic
1186323578 X:8455243-8455265 TGAAGAGGAGAAGGAGCAGCTGG + Intergenic
1186777704 X:12882307-12882329 TATAGAGGAGAAGGGGGAGCAGG + Intronic
1188368292 X:29336977-29336999 TTTGGAGGAGAAAGGGGAGCCGG + Intronic
1189731731 X:44028039-44028061 TGTGAATGTGACGAGGCAGCAGG - Intergenic
1189739340 X:44102312-44102334 AGGGGATGAGCAGGGGCAGAGGG - Intergenic
1190084826 X:47386314-47386336 TGTGGTTGTGAAAGGGCAGCAGG - Intronic
1190103013 X:47537224-47537246 TGTGGTTGCGAAAGGGCAGCAGG + Intergenic
1190875748 X:54459038-54459060 TGTGTAGGAGAAAAGGCAGCTGG - Intronic
1192468001 X:71371414-71371436 TTTGGTGGAGAAGGAGCAGCAGG + Intronic
1195384088 X:104297220-104297242 TGGGGTGGAGATGGGGCAGCTGG + Intergenic
1195465215 X:105172227-105172249 TGTGGAGGAGAAAGGGAAGGAGG + Intronic
1195707252 X:107746585-107746607 TGTGTTTGTGAAGGGACAGCTGG - Intronic
1195751113 X:108162728-108162750 TGGGGAGAAGAAGGGCCAGCAGG - Intronic
1197160154 X:123313872-123313894 TCTGCTGGAGAAGGGGCAGCAGG + Intronic
1197793051 X:130274288-130274310 TGAGGATGAGAAGGGATAGAAGG + Intergenic
1198310818 X:135424899-135424921 GGTGGATGAGAGGGGCCAGCAGG - Intergenic
1198373637 X:136015981-136016003 TGTGAATGGGATGGGGCAGGCGG + Intronic
1199074385 X:143512226-143512248 TGAGGATGAGTAGGGGGAGAGGG - Intronic
1199214947 X:145252673-145252695 TGAGGATGAGTAGGGGGAGAGGG + Intronic
1199874481 X:151919990-151920012 TGTGGATGGGAATGGGAAGGGGG - Intronic
1199903634 X:152203037-152203059 TGTAGATGAGAAGCAGCAGAGGG + Intronic
1200058318 X:153472888-153472910 TGTGGATGTGGCGGGGAAGCTGG + Intronic
1200430337 Y:3072667-3072689 TGTGGAGGGGGAGGCGCAGCGGG + Intergenic
1201488550 Y:14517063-14517085 TTTGGATTAGAAGGGGCATGGGG + Intergenic
1202349709 Y:23975074-23975096 TGTGCATGTGTAGGGGCAGTGGG - Intergenic
1202521070 Y:25695046-25695068 TGTGCATGTGTAGGGGCAGTGGG + Intergenic