ID: 1007418367

View in Genome Browser
Species Human (GRCh38)
Location 6:41705281-41705303
Sequence CTCATTGTTCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007418367_1007418370 2 Left 1007418367 6:41705281-41705303 CCCAGCTCCATCTGAACAATGAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1007418370 6:41705306-41705328 ACCTACGTCCTGCCCACCTGAGG No data
1007418367_1007418372 6 Left 1007418367 6:41705281-41705303 CCCAGCTCCATCTGAACAATGAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1007418372 6:41705310-41705332 ACGTCCTGCCCACCTGAGGTTGG No data
1007418367_1007418378 28 Left 1007418367 6:41705281-41705303 CCCAGCTCCATCTGAACAATGAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1007418378 6:41705332-41705354 GCAAGGACCCAAATTTTAATTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1007418367_1007418374 11 Left 1007418367 6:41705281-41705303 CCCAGCTCCATCTGAACAATGAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1007418374 6:41705315-41705337 CTGCCCACCTGAGGTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007418367 Original CRISPR CTCATTGTTCAGATGGAGCT GGG (reversed) Intronic
900601326 1:3504028-3504050 CTCATTCCCCAGATGGAGGTGGG + Intronic
901597578 1:10397906-10397928 GTCATTGTTGAGATGGAGTCTGG - Intergenic
902187756 1:14738146-14738168 GTCATTTATCACATGGAGCTGGG - Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902407458 1:16192459-16192481 CCCATTTTGCAGATGGGGCTTGG + Intergenic
903286060 1:22277431-22277453 CACATGGTTCAGAAGCAGCTGGG - Intergenic
904651548 1:32009665-32009687 ATAATGGTTCAGATGGAGGTTGG - Intergenic
905329888 1:37187222-37187244 CTCATTGTGGAGATGGGGTTGGG - Intergenic
905468211 1:38171893-38171915 CTGATTGGTCAAGTGGAGCTAGG - Intergenic
909555988 1:76954799-76954821 CTCTGTGGTCAAATGGAGCTGGG + Intronic
909724627 1:78819520-78819542 CTCATTGTTGAGGTGGGGCCTGG + Intergenic
917074463 1:171189591-171189613 TTCATTGTGCAGAAGCAGCTAGG + Intronic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
920064257 1:203255456-203255478 CTGATTCTTCTGATGGATCTGGG + Intronic
922816281 1:228452138-228452160 CTCAGTGTTCGGTTGGGGCTGGG + Intergenic
1064406652 10:15070165-15070187 CTCATTGTTAGGATGGAGTGTGG + Intronic
1065687212 10:28298236-28298258 GTGATTGTTCTGATGGATCTTGG - Intronic
1068145389 10:53062937-53062959 CCAATTGCTCAGATTGAGCTTGG + Intergenic
1069736264 10:70656709-70656731 CTCATAGTTCAGATGAGGCTGGG + Intergenic
1069995863 10:72341796-72341818 CTCATTGGTGAAATGGAGATAGG - Intronic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1072660685 10:97361711-97361733 CTCTTGGTTCAGCTGGTGCTTGG + Intronic
1073611327 10:104946880-104946902 CTCAGAGTTCAGAGGGAGCAAGG - Intronic
1073727373 10:106248924-106248946 CTCATTTTACAGAAGGAACTTGG - Intergenic
1076282596 10:129261123-129261145 CTGACTCTTGAGATGGAGCTTGG - Intergenic
1077141518 11:1026886-1026908 CTCATGGTTCAGCTGGGGCCCGG + Intronic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1079477268 11:20844263-20844285 CTCATAGTTTAGATGGAGATGGG + Intronic
1080099744 11:28446054-28446076 CTCTCTGTCCAGATTGAGCTGGG + Intergenic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1080477909 11:32613972-32613994 CTCATTGTTAAGATGAAGATGGG + Exonic
1084495865 11:69502699-69502721 CTCAGTGGGCAGATGCAGCTGGG - Intergenic
1084739023 11:71126566-71126588 CAGATTCCTCAGATGGAGCTGGG + Intronic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1085634721 11:78149669-78149691 ATCCTAGTTCACATGGAGCTTGG - Intergenic
1086097997 11:83069784-83069806 TTCATTGTTCACATGCTGCTGGG + Intronic
1087109617 11:94449527-94449549 CTCATTGTTCAGCCTCAGCTGGG - Intronic
1089300018 11:117492920-117492942 CTCATGCTTCAGGTGGAGCTTGG - Intronic
1089745417 11:120613624-120613646 TTCATGCCTCAGATGGAGCTTGG + Intronic
1090048134 11:123354171-123354193 ATCATTGTCCATATGTAGCTTGG - Intergenic
1091175460 11:133553805-133553827 CTCATTGCTCAGATCGATCTGGG - Intergenic
1091184803 11:133637614-133637636 GTGATTGTTCCGATGGAGCTTGG - Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092501580 12:9052719-9052741 CTCATTTTTCACTTGGAGCTTGG + Intergenic
1093461918 12:19414634-19414656 TTCATTGTTCAGATAAAGCTGGG - Intronic
1093658450 12:21724772-21724794 CTGATTTCTCTGATGGAGCTGGG + Intronic
1094467057 12:30764510-30764532 CGCCTTGTTCAGATGGGGATGGG - Intergenic
1094487081 12:30933823-30933845 CTCTTGGTTCAGATTGAGTTGGG + Intronic
1099602837 12:84763404-84763426 CTCATTGTTCAACTTCAGCTGGG - Intergenic
1100179084 12:92064460-92064482 TTCATTGGTCAGAATGAGCTAGG + Intronic
1100221108 12:92505423-92505445 CTCATTCTTAGGATGGAGCAGGG + Intergenic
1100291777 12:93222075-93222097 CTCATTGTTAGATTGGAGCTGGG - Intergenic
1101123138 12:101604163-101604185 CTCATTGTTAACATGGGGCTGGG - Intronic
1104469659 12:129019271-129019293 CTATTGGTTCAGATGGGGCTTGG - Intergenic
1104809054 12:131609566-131609588 CTCACTTGTCAGAGGGAGCTAGG - Intergenic
1105849969 13:24324836-24324858 ATCATTGTTCAGAGGGATATTGG - Intergenic
1106925368 13:34607699-34607721 CTCAGTGTTCAGCAAGAGCTTGG - Intergenic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1111617076 13:90673265-90673287 CTCATTTTTCAGAGGCAGATAGG - Intergenic
1112224639 13:97526581-97526603 CTCATTTCTCAGTTGCAGCTTGG + Intergenic
1114491439 14:23104687-23104709 ATCATATATCAGATGGAGCTTGG - Intergenic
1115517182 14:34197607-34197629 CTCAGTGTTCAGTTTGAGTTAGG - Intronic
1115533978 14:34355253-34355275 ATTAATGTTGAGATGGAGCTAGG - Intronic
1117599725 14:57362829-57362851 CTTATTGTTGAGATGGAGCAGGG - Intergenic
1119682699 14:76604806-76604828 CTCCCAGTTCAGATGGGGCTTGG + Intergenic
1120222856 14:81754711-81754733 CCCAGAGTTGAGATGGAGCTGGG + Intergenic
1121379917 14:93455962-93455984 CTCATTGTTGAGATGAGGCAAGG + Intronic
1123482385 15:20644204-20644226 CTAATTGTTGAGAGGGAGCTTGG + Intergenic
1124065959 15:26344085-26344107 CTCATTGTTCAGGTCCTGCTGGG + Intergenic
1124246870 15:28078627-28078649 CTCAGTGTTCAGCTGGAGCAAGG - Intronic
1124828485 15:33124350-33124372 CTCATTGATCAGAAGTAGCCCGG - Intronic
1126656549 15:50984097-50984119 CTCTTGGTTCAGATGTATCTGGG + Exonic
1127081329 15:55383031-55383053 GTGATTGTTCTGATGGATCTGGG - Intronic
1127625064 15:60772268-60772290 CTCATTGTTCAGTTCAAGGTGGG + Intronic
1131587340 15:93710063-93710085 TTCATTGTGGAGATGGAGCATGG + Intergenic
1132967509 16:2666867-2666889 CCCATTGTTTAGAGGGGGCTGGG + Intergenic
1132990691 16:2791325-2791347 CTCCCTGTTCAGTGGGAGCTGGG + Intergenic
1139490686 16:67284473-67284495 CTCATGGATCACTTGGAGCTGGG - Intronic
1141769126 16:86078256-86078278 CTCATTGCTCAGTTTGAGCATGG - Intergenic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1143903949 17:10195341-10195363 TTCCTTGTTCAGATGAAGCAAGG - Intronic
1145043713 17:19595860-19595882 CTGATTGATGTGATGGAGCTCGG + Intergenic
1147246348 17:39123669-39123691 CTGACGTTTCAGATGGAGCTGGG - Intronic
1147791190 17:43015248-43015270 TTCCTTGTTCTGGTGGAGCTGGG - Exonic
1148957310 17:51364520-51364542 CTGATTGTTCAGATGGAAAGTGG + Intergenic
1150198953 17:63333177-63333199 ATGATTGTTCTGATGGATCTGGG + Intronic
1155410707 18:25541767-25541789 ATCCTTGGGCAGATGGAGCTAGG + Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1157519333 18:48334592-48334614 CTCATTCTTCAGATGGGGCTGGG + Intronic
1158294102 18:55974945-55974967 CTCATGATTCACATGGTGCTGGG + Intergenic
1163335297 19:16667389-16667411 CTCTTTCCTCACATGGAGCTTGG - Intronic
1165636879 19:37347800-37347822 CTCATTGCTCAGCTGGAGCGAGG + Exonic
1166147914 19:40849972-40849994 CTCACTGATCTGATGGAGGTGGG + Exonic
1166932288 19:46308555-46308577 CCAATTGTTGGGATGGAGCTGGG + Intronic
1167342884 19:48926408-48926430 CTCATTGTTCAGGTGCAGCTGGG - Intergenic
1168032109 19:53688766-53688788 TTCATTTTTGAGATGGAGCCTGG + Intergenic
929018279 2:37524193-37524215 CTCATTTTTCAAATGGAGGAGGG + Intergenic
934717666 2:96552868-96552890 CTCATTGTGGAGATGGGGATTGG + Intergenic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
935039841 2:99415580-99415602 CTCAGTGGTCACATGGAGCAAGG - Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940041645 2:149367795-149367817 CCCATTGTTTTGCTGGAGCTCGG - Intronic
940471492 2:154105781-154105803 CTCAATATTCACATGGGGCTAGG - Intronic
941575654 2:167226877-167226899 CTCCTTGTTCAGCTGGGGCATGG + Intronic
943333994 2:186591179-186591201 GTCATTGTTCAGAAGGAACAAGG + Intronic
945820212 2:214654891-214654913 TTCAATGTTCACATGGGGCTGGG + Intergenic
946172137 2:217901943-217901965 CTCATTGGTCCGAGGCAGCTGGG - Intronic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
948775720 2:240287922-240287944 CACATTGTTCAAATGGATGTGGG - Intergenic
1169348242 20:4846939-4846961 CCCATTGCTCACATGGAGCAAGG + Intergenic
1169823671 20:9742401-9742423 CTCATTAATCAGATGGAAGTGGG + Intronic
1172112457 20:32555079-32555101 CACATGGTGCAGATGTAGCTGGG - Intronic
1172769661 20:37373733-37373755 ATGATTTTTAAGATGGAGCTAGG - Intronic
1174222683 20:48969837-48969859 CCCATTTTTCAGATGAGGCTTGG - Intronic
1176104281 20:63378415-63378437 CTCGTTGTTCAGATGTCTCTGGG - Intergenic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
1183716267 22:39535283-39535305 CTCATTGGTTGGATGGGGCTTGG + Intergenic
1184594256 22:45504297-45504319 CTGATTGTTCAGGCGGTGCTGGG + Intronic
949323900 3:2842476-2842498 CACATTGTTCCGATGCAGGTAGG - Intronic
950150539 3:10683440-10683462 CTCATTCTTCATGTGGAACTGGG + Intronic
950365590 3:12481400-12481422 CTCCTTGTTCACCTGCAGCTGGG - Intergenic
952844062 3:37672094-37672116 CCCAGGGTTCAGCTGGAGCTGGG + Intronic
953025714 3:39143799-39143821 CTCATTGTTCATGGGGGGCTTGG + Exonic
954223571 3:49168881-49168903 CTCTCTGCTCAGATAGAGCTGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
959313452 3:104771493-104771515 CTCAAGGTTCAGTTGGAGCATGG + Intergenic
960683142 3:120270021-120270043 CTCATTGTTCACACAGGGCTGGG - Intronic
963877648 3:150494499-150494521 CTCATTGTTCAGATGAAATGTGG - Intergenic
965627557 3:170696783-170696805 CTCATTATTCTGAAAGAGCTGGG + Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
966965731 3:184990539-184990561 CTAACTGTGCAGATTGAGCTGGG + Intronic
967406914 3:189126688-189126710 CTCATTGTTCAAATGGAAATTGG + Intronic
967927376 3:194662158-194662180 CTCACTGTTCAGATGGATTACGG - Intronic
969957613 4:10907893-10907915 CTCCTAGTTCAGAGGGGGCTAGG + Intergenic
972280279 4:37595687-37595709 CTCATTATTCAAATAGAGCAGGG - Intronic
972379558 4:38506393-38506415 CTCATTGTTCAGAATGCACTTGG - Intergenic
977160108 4:93623367-93623389 CTCATTGTTCATGTGGTGTTTGG + Intronic
977960134 4:103076207-103076229 CTAATCGTTCAGACGGAGCCTGG - Exonic
984375952 4:178929472-178929494 ATCAATGTTCACATGTAGCTAGG - Intergenic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
986574296 5:9196593-9196615 CCCAGTGTTCAGAAGAAGCTGGG - Intronic
988211958 5:28215382-28215404 CTAATTGTTTTGATGTAGCTAGG + Intergenic
988604577 5:32668565-32668587 CTCTTCGTTCAGACTGAGCTGGG + Intergenic
989704089 5:44307064-44307086 TTCATATTTCAGATGAAGCTAGG + Intronic
995299759 5:110565578-110565600 CTCTTTATTCAGATGGGACTTGG - Intronic
995783125 5:115798842-115798864 CTCATTGCTGAAATGGAGCAGGG + Intergenic
996364232 5:122683445-122683467 CTCATTGTTCACTTGTAACTTGG - Intergenic
997386164 5:133474434-133474456 CTCAGTGCACTGATGGAGCTAGG - Intronic
998827772 5:146121757-146121779 CTCATTGTTCAACTCCAGCTTGG - Intronic
999249326 5:150172733-150172755 CTCATCGCTCAGATATAGCTGGG + Intronic
999325688 5:150642053-150642075 CTCATTCTGCAGATGAAACTGGG - Intronic
1001391524 5:171383295-171383317 TTCCTGGTTCAGACGGAGCTTGG - Intergenic
1003830848 6:10009646-10009668 GCCATTGCTCTGATGGAGCTGGG - Intronic
1004503520 6:16229349-16229371 CTCTTTTTCCAGATAGAGCTGGG + Intergenic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1010259523 6:73799148-73799170 CTCATTTTTCAGAGGCAGCCAGG - Intronic
1016290891 6:142527111-142527133 CCCATTCTTCAGAAGGAGATGGG - Intergenic
1017306619 6:152925618-152925640 CTCAGTTTTCTGATGGATCTAGG - Intergenic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1022891244 7:34702130-34702152 CTCATGGTACAGATGGCGGTTGG + Intronic
1026827078 7:73591163-73591185 CTGATCCTTCAGATGGGGCTGGG - Intergenic
1026898858 7:74026390-74026412 CTCTGTGTTCAGCTGGTGCTAGG - Intergenic
1031821216 7:126504091-126504113 CTCATTTTTCTCATGGAGTTTGG + Intronic
1037577862 8:20224849-20224871 TTCATTGTTCAGATAAAACTTGG + Intronic
1037993942 8:23339544-23339566 CGCCTTGTTCAGATGGCGTTTGG - Intronic
1040101051 8:43505662-43505684 CTCTTTCTCCATATGGAGCTTGG - Intergenic
1044030813 8:87234331-87234353 ATAATTATTCTGATGGAGCTGGG - Intronic
1045326210 8:101119510-101119532 CCCATTGTACAGGTGGGGCTCGG - Intergenic
1046748220 8:117898406-117898428 CTCAGTGGACAGAAGGAGCTAGG + Intronic
1047290503 8:123525452-123525474 CTCATTCTACAGAGAGAGCTAGG + Intronic
1047314310 8:123718328-123718350 CTCATTGGTCACCTGCAGCTTGG + Intronic
1048419898 8:134267861-134267883 CTCATTGTCCACATGATGCTTGG + Intergenic
1048419965 8:134268390-134268412 CTCATTGTCCACATGCTGCTTGG - Intergenic
1049149976 8:141028504-141028526 CTTATTTATCAGATGAAGCTGGG + Intergenic
1049880612 8:145059786-145059808 CTCATTGTTTAGAGGGGCCTGGG - Intergenic
1058768768 9:108209722-108209744 CTCATTTGTCAGATAAAGCTGGG - Intergenic
1058806921 9:108601845-108601867 ATCATTGTTCTCATGGAGGTGGG - Intergenic
1059620088 9:115994680-115994702 CTCAGTATTCTGATGGAGCAAGG - Intergenic
1186135306 X:6513399-6513421 TTCATTCTTCAAATGGAGATTGG - Intergenic
1187710945 X:22053793-22053815 CTTATTGTTCTGCTGAAGCTGGG - Intronic
1190984792 X:55490391-55490413 CTCAGTGTTCACATTGGGCTAGG - Intergenic
1197303709 X:124814196-124814218 TTCATTGTGCAGATGAAACTGGG - Intronic
1199870403 X:151893313-151893335 CTCATTGTACCGATGGAACTTGG + Intergenic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic