ID: 1007420041

View in Genome Browser
Species Human (GRCh38)
Location 6:41713720-41713742
Sequence CTATTCTCCCCAGAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007420039_1007420041 -4 Left 1007420039 6:41713701-41713723 CCTTTGCATGAATCATTTTCTAT 0: 1
1: 0
2: 2
3: 33
4: 417
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420031_1007420041 26 Left 1007420031 6:41713671-41713693 CCTCAGGCTGTGGCCAAAACAGG 0: 1
1: 0
2: 2
3: 23
4: 213
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420036_1007420041 13 Left 1007420036 6:41713684-41713706 CCAAAACAGGGAGGGCCCCTTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420038_1007420041 -3 Left 1007420038 6:41713700-41713722 CCCTTTGCATGAATCATTTTCTA 0: 1
1: 2
2: 0
3: 27
4: 406
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420037_1007420041 -2 Left 1007420037 6:41713699-41713721 CCCCTTTGCATGAATCATTTTCT 0: 1
1: 0
2: 3
3: 47
4: 421
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007420041 Original CRISPR CTATTCTCCCCAGAGCCAGG AGG Intronic
900736064 1:4300257-4300279 CCTCTCTCCCCAGAGCCAGCAGG - Intergenic
901394964 1:8974414-8974436 CTAAGCTGCCCAGAGCCAAGGGG - Exonic
901647001 1:10722214-10722236 CTGTTCTCCCTAAAGCCATGGGG - Intronic
903969950 1:27112228-27112250 CTATTCTACCCAGCCCCATGAGG + Intronic
904730564 1:32587853-32587875 CTCTCCTCCCCAGAGGCTGGGGG - Intronic
904947447 1:34209816-34209838 ATATTCTCTCTGGAGCCAGGTGG - Intronic
905378852 1:37545310-37545332 CTAATTTCCCCATAGCCATGGGG + Intronic
906586833 1:46985462-46985484 CTGCTCTCTTCAGAGCCAGGAGG - Intergenic
909852824 1:80489943-80489965 TTATTTTCCCCATAGCCATGTGG + Intergenic
911625856 1:100123800-100123822 CTATTCTCTCCTAGGCCAGGTGG + Intronic
913551192 1:119918457-119918479 CCATTCCCTCCACAGCCAGGCGG + Exonic
915093264 1:153441365-153441387 TTATACTGCCCAGGGCCAGGAGG + Intergenic
916058294 1:161082756-161082778 CTGTTCTTTCCAGTGCCAGGAGG - Intronic
917232747 1:172855814-172855836 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
918148782 1:181780763-181780785 GTCTTGTCCACAGAGCCAGGTGG + Intronic
919468890 1:197954439-197954461 CTCTCCTCCCCATAGCCTGGTGG - Intergenic
920843623 1:209575639-209575661 CTACTCTCCCTAGGGCCAGCTGG + Intergenic
921649432 1:217658915-217658937 CTATTGTCGCCTGAGCCACGAGG + Intronic
923147645 1:231209327-231209349 CTGCTGTCCCCAAAGCCAGGAGG + Intronic
924236117 1:242000850-242000872 CTACCCTCCCCAGAGGCTGGAGG + Intergenic
1065120941 10:22530021-22530043 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
1067252068 10:44594714-44594736 CTAGACTCTCCAGAGCCAGCAGG - Intergenic
1073023077 10:100463080-100463102 ATATTCTCCTCAGTGCCAGTGGG - Exonic
1073324502 10:102634500-102634522 CTTTTCTCCCCGGAGACTGGGGG + Intergenic
1073512800 10:104053039-104053061 CCTTTCTCTCCAGATCCAGGAGG + Exonic
1076727845 10:132421684-132421706 CTTTTCTCCGCAGAGAGAGGCGG + Intergenic
1077124066 11:924835-924857 CTGTCCTTCCCAGAGCCAGATGG - Intergenic
1078251905 11:9623291-9623313 CCATTTTGCCCAGAGCCAGCAGG + Intergenic
1079712411 11:23702427-23702449 ATAGTTTCCTCAGAGCCAGGTGG - Intergenic
1079968580 11:27008082-27008104 CCTTTCTACCAAGAGCCAGGAGG - Intergenic
1081566723 11:44265056-44265078 CTGCTGGCCCCAGAGCCAGGGGG + Exonic
1083081260 11:60095739-60095761 CTATTCTCTCCACAGCCTGCTGG + Exonic
1084173852 11:67413326-67413348 GTATTCTCCCCCAGGCCAGGAGG + Intronic
1084627435 11:70319228-70319250 CTGTTCACCACAGAGCCAGCAGG - Intronic
1086805688 11:91239498-91239520 CTATTCCTGCCAGGGCCAGGAGG + Intergenic
1089338934 11:117744706-117744728 CTATTCTGGCCTGAGCCAGAGGG + Intronic
1089633999 11:119800814-119800836 CTTCTCCCCCCAGGGCCAGGTGG + Intergenic
1090037908 11:123264692-123264714 TTTTTCTACCCAGAGCCAAGAGG + Intergenic
1090575810 11:128102204-128102226 CTGTTCTCCCCAGAGCAAGAGGG + Intergenic
1091991982 12:4962852-4962874 CTATTTTGCACAGAGACAGGTGG - Intergenic
1094425308 12:30310598-30310620 CTAGACTCTCCAGAGCCAGCAGG - Intergenic
1096833250 12:54330971-54330993 CTATTCTGCCCAAAAACAGGAGG - Intronic
1097511008 12:60540165-60540187 CTCTTCTTGCCAGAGCCATGAGG - Intergenic
1098706944 12:73702899-73702921 CTATTCTCTTCAGAGCCGGCAGG - Intergenic
1100195618 12:92241164-92241186 CTATTCTCCCCAGGCCTGGGTGG - Intergenic
1101287121 12:103326361-103326383 CTATTCTCCATAGAGCCACCAGG + Intronic
1104217001 12:126743319-126743341 GTCTTCTCCCCAAATCCAGGAGG - Intergenic
1104801227 12:131556310-131556332 CTGTTCTCCCGAGGGCCAGGGGG - Intergenic
1106308722 13:28534823-28534845 CTGTGCTCCACAGAGCCAGCAGG + Intergenic
1106400574 13:29426088-29426110 CTATTGTGGACAGAGCCAGGTGG - Intronic
1108745396 13:53388214-53388236 CCATTCTCCCCAGAGCTCAGCGG + Intergenic
1109891211 13:68617225-68617247 CTGTTCTCTTCAGAGCCAGCAGG - Intergenic
1118132771 14:62986149-62986171 CCATTCTCCACAGAGCCACTAGG + Intronic
1118888987 14:69891592-69891614 CTACCCTCCTCAGGGCCAGGAGG + Intronic
1120259498 14:82163758-82163780 CTCTTCTCAGCACAGCCAGGGGG - Intergenic
1120949232 14:90025918-90025940 ATATTATTCCCAGAGGCAGGAGG - Intronic
1123012943 14:105357989-105358011 CTGGTCTCCCCACAGCCTGGAGG - Intronic
1123115409 14:105892177-105892199 CTTCTCCTCCCAGAGCCAGGAGG + Intergenic
1125329950 15:38573136-38573158 CTGCTCTCTTCAGAGCCAGGAGG + Intergenic
1125616735 15:41020953-41020975 CAGTTCTTCCCAGAGCCAGCTGG - Exonic
1126341549 15:47646113-47646135 CTATCCTCCCCAGAGGTTGGAGG + Intronic
1126781252 15:52140533-52140555 CTTTTGGCCCCAGAGCCACGTGG + Intronic
1126956229 15:53936198-53936220 CCAGACTCCCCAGAGCCAGCAGG - Intergenic
1127262969 15:57339193-57339215 CTCTTCTCCCCAGAATCAGGAGG + Intergenic
1127649277 15:60991159-60991181 CTCTTCTTCTCAGAACCAGGTGG + Intronic
1127830140 15:62743376-62743398 CTTTTCTTCCCAGAGCAAGAAGG - Intronic
1128481634 15:68045404-68045426 CTGTGCTCCACAGAGCCAGCAGG + Intergenic
1129799858 15:78405748-78405770 GCATGCTCCACAGAGCCAGGAGG + Intergenic
1130157774 15:81367877-81367899 CTGTGGTCTCCAGAGCCAGGAGG - Intronic
1131054990 15:89369786-89369808 TTCTCCTCCCCAGAGCCAAGGGG - Intergenic
1131454207 15:92570727-92570749 CTCTTCTCCCCCGGGCCAGCAGG + Intergenic
1131792802 15:95983392-95983414 ATAGTCTCCCCAGAGACATGAGG + Intergenic
1132809336 16:1790064-1790086 CTCCCCTCCCCTGAGCCAGGTGG + Intronic
1135269044 16:21053286-21053308 ATATTCACCCAAGAGCCAGGAGG - Intronic
1138081328 16:54093865-54093887 GCCTTCTTCCCAGAGCCAGGGGG + Intronic
1138898305 16:61237435-61237457 CAATTCTCCCCATAACCAAGTGG + Intergenic
1139571336 16:67814567-67814589 CCCTTCTCCCCAAAGCCTGGTGG - Intronic
1139748563 16:69094273-69094295 TTGTTCTCCCCAGCGCCAGGTGG - Intergenic
1141722750 16:85765933-85765955 CTCTTATCCCCAGAGGTAGGAGG - Intergenic
1144462917 17:15472637-15472659 CTCTCCTCCCCAGAGACTGGGGG - Intronic
1144635996 17:16909548-16909570 CCATTCTCCCCACACCCAAGTGG + Intergenic
1145941083 17:28743791-28743813 CGCTTCTCCCCAGAGCCCGCGGG - Intergenic
1146861692 17:36307143-36307165 GTATTCTCTCCATTGCCAGGAGG + Intronic
1147092021 17:38111247-38111269 GTATTCTCTCCATTGCCAGGAGG + Intergenic
1147105190 17:38209248-38209270 GTATTCTCTCCATTGCCAGGAGG - Intergenic
1147250083 17:39147960-39147982 CTACTCTACACAGAGCCATGAGG + Intronic
1148424311 17:47579236-47579258 GTATTCTCTCCATTGCCAGGAGG + Intronic
1149231869 17:54544387-54544409 CTAGTCTCCCCAGCTCCAGCAGG - Intergenic
1149483991 17:57027480-57027502 CTTTTCTCAGCATAGCCAGGGGG + Intergenic
1149838341 17:59935193-59935215 CTATTCTCCCCAGTGAATGGGGG - Exonic
1150849880 17:68694550-68694572 TCATTCTTCCCAGAGTCAGGAGG + Intergenic
1151696003 17:75717900-75717922 GTTTTCTCCTCAGAGCCAAGGGG - Intergenic
1153469870 18:5432131-5432153 CTATTCTCCCCAAATCCCTGTGG + Intronic
1155014342 18:21817667-21817689 CTATGCTCCCCTAAGCCATGTGG - Intronic
1157440898 18:47710925-47710947 CTATTGTGCCCAGGTCCAGGTGG - Intergenic
1158398982 18:57104000-57104022 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
1160152262 18:76404216-76404238 CCATGAACCCCAGAGCCAGGGGG + Intronic
1160734113 19:654051-654073 CGCTTCTCCCCAGAGTCAGTGGG - Intronic
1163175341 19:15560893-15560915 CTCTTCTCCCCAGACCTAGCTGG + Intergenic
1164219554 19:23181157-23181179 GTACTCTTCCCAGAGCCAGCCGG - Intergenic
1164565745 19:29324618-29324640 CCACTCTCCCCACAGCCAGGTGG + Intergenic
1165313853 19:35043143-35043165 CTTTTGCCCACAGAGCCAGGAGG - Intronic
1166888524 19:45975480-45975502 CCATTGTCCCCAGAGCCAAGGGG + Intergenic
1167071010 19:47221909-47221931 CTCTTTTCCCCAGAGACAAGAGG - Exonic
1167772564 19:51530397-51530419 CTGTTCTCTCCAGGGCCAGATGG - Intronic
925261997 2:2536990-2537012 CTATCCTTCTCAGAGGCAGGAGG + Intergenic
928115398 2:28542384-28542406 CTGGTCACCCCAGAGCTAGGAGG - Intronic
928138311 2:28705689-28705711 CTATTCTACCTGGAGCCAGAAGG - Intergenic
928449504 2:31365930-31365952 TTCTTCTTCCCAGAGCCAGATGG + Intronic
928881798 2:36105179-36105201 CTATTTTCTCCAGAGCCAACAGG - Intergenic
929905206 2:46039819-46039841 ATATTCTCCACTGATCCAGGAGG + Intronic
932129313 2:69173506-69173528 CTATTCTCACCATGGCCACGGGG - Intronic
933095829 2:78179449-78179471 CAATACTCCACAGAGCCTGGAGG + Intergenic
934060094 2:88284808-88284830 CCATTCTCCCCTGTGCCAGAAGG + Intergenic
934663554 2:96155494-96155516 CCATGCTCCCCAGATCCTGGAGG + Intergenic
935567898 2:104629243-104629265 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
935596238 2:104880224-104880246 CTGTTCACTCCACAGCCAGGAGG + Intergenic
937937576 2:127258528-127258550 CTTTCCTCCCCCGACCCAGGGGG - Intronic
938844809 2:135197571-135197593 TTAGTAGCCCCAGAGCCAGGAGG - Intronic
941119643 2:161513772-161513794 CTGCTCTCCTCAGAGCCAGCAGG - Intronic
941441134 2:165538305-165538327 CTATTTTCCCCAAAACCAGTAGG + Intronic
941478095 2:165972372-165972394 CTGTTCTCTTCAGAGCCAGCAGG - Intergenic
941639923 2:167976480-167976502 CTCTTCTCCCCCTAGCCTGGTGG - Intronic
942882087 2:180872836-180872858 CTAATTTCCCCATAGCCATGGGG - Intergenic
944101788 2:196035713-196035735 CAGTTCAGCCCAGAGCCAGGAGG + Intronic
944424283 2:199563297-199563319 TTGTTCTCCCCAGACCCTGGTGG + Intergenic
945925434 2:215798457-215798479 CTAGTCTCCCCTTAGCCATGGGG + Intergenic
946110510 2:217411146-217411168 CCATTCTCCCCAGAGTCTAGAGG + Intronic
946581023 2:221128335-221128357 CTATACTCCACAGAGCCACAGGG + Intergenic
947587545 2:231365918-231365940 CTATTTTCTCCAGTGCCAGTGGG + Intronic
949009981 2:241672846-241672868 CTTTTCTCCCCAAAGCAAGGAGG - Exonic
1170107209 20:12764390-12764412 TAATTCTCACCACAGCCAGGGGG + Intergenic
1171030494 20:21672290-21672312 GTTTTCTCCTCAGAGCCAGGAGG - Intergenic
1172962303 20:38807334-38807356 CTCATCTCCCCACAGCCTGGCGG - Intronic
1174088438 20:48027167-48027189 CTATTCCCCACAGAGCCCGGAGG + Intergenic
1174514759 20:51083231-51083253 CTAGCCTACCCAGGGCCAGGGGG - Intergenic
1178711813 21:34923929-34923951 CTATAGTCCCCAGTGCCAGGAGG + Intronic
1178902063 21:36606069-36606091 TTCGCCTCCCCAGAGCCAGGAGG + Intergenic
1179640716 21:42745738-42745760 CCCCTCTGCCCAGAGCCAGGCGG + Intronic
1179724648 21:43335388-43335410 CTTCTCTGCCCACAGCCAGGAGG - Intergenic
1179883667 21:44304352-44304374 CTGGTCTCCCCAGCTCCAGGCGG - Intronic
1183323724 22:37180394-37180416 CCCTTCTCCCCAGAGGGAGGCGG - Exonic
1183360195 22:37379363-37379385 CTCTTCTGCCCAGAGCCCGGTGG + Intronic
1185372930 22:50469288-50469310 CTAAGCTCCCCTGGGCCAGGAGG + Intronic
1185418940 22:50724554-50724576 CTGTTCTCCCAGGAGCCAGGGGG + Intergenic
950188603 3:10960768-10960790 CTCTTGTCCCCACAACCAGGAGG + Intergenic
950287996 3:11760192-11760214 CTATGCTTCCCAAAGCCTGGAGG + Intergenic
952359455 3:32615264-32615286 TTATTATCTCCAGAGCCAGAGGG - Intergenic
953074111 3:39551792-39551814 CTGCTCTCCTCAGAGCCAGCAGG - Intergenic
953635749 3:44662529-44662551 CTACTCTCAGCAGAGACAGGGGG - Intergenic
953915932 3:46921298-46921320 CCACTCTCCCCAGCCCCAGGCGG - Intergenic
955629320 3:60955374-60955396 CTATTCACCCCAGAACTAAGGGG - Intronic
955768510 3:62368721-62368743 CAATGTTCCCCAGCGCCAGGAGG - Intergenic
955957333 3:64304182-64304204 CTATACTCTCCAGAACCAGAGGG + Intronic
956335116 3:68154792-68154814 CTATTCTCCCCAGTGCCCTTGGG + Intronic
956611640 3:71129780-71129802 CTCTTCTACTCAGAGCCAGGAGG + Intronic
956818385 3:72929606-72929628 CTAATTTCCCCATAGCCATGGGG + Intronic
957249720 3:77757342-77757364 CTGTTCTCTTCAGAGCCAGCAGG - Intergenic
961385193 3:126519195-126519217 CTCTCCTCCCCAAAGTCAGGAGG - Intergenic
961694315 3:128693740-128693762 CTCTCCTCCCCAAAGTCAGGGGG + Intergenic
961703346 3:128764435-128764457 CTAATTTCCCCATAGCCATGGGG - Intronic
962461460 3:135618246-135618268 GCATTCTCCTCAGAGCCAGGAGG + Intergenic
962838117 3:139206502-139206524 CTAACCTCCCCAGAGGCAGATGG - Intronic
963227232 3:142874647-142874669 CTGTTCTGCCCAGAAGCAGGTGG + Intronic
965300949 3:167003638-167003660 CTATTCTCCCCAAAGGTAAGGGG - Intergenic
967258993 3:187623480-187623502 CGATTCTCCCCACAGCCTTGAGG + Intergenic
967754220 3:193150175-193150197 CTTCTCTCCCCACAGCCAGGAGG - Intergenic
968896254 4:3405535-3405557 CTCTTTTCCCCAGAGCAGGGTGG - Intronic
969239141 4:5888046-5888068 CCATTGTCCCCAGAGGCTGGGGG + Intronic
969635805 4:8369040-8369062 CTATGGAACCCAGAGCCAGGGGG + Intronic
969831938 4:9804951-9804973 CTATCCTCCCTAGAGCCAGAGGG + Intronic
974754650 4:66187351-66187373 AGATTCACCCCAGAGCCAGGTGG - Intergenic
975998206 4:80340670-80340692 CTAGACTCCCCAGAGCCAGAAGG - Intronic
976711010 4:88071822-88071844 CTAATATCCACAGAGGCAGGAGG - Intronic
978940431 4:114429488-114429510 CCAGTCTCCCCAGTGCCAGCAGG + Intergenic
979012376 4:115387845-115387867 CTGTTCTCTTCAGAGCCAGCAGG - Intergenic
980769381 4:137351476-137351498 CTACTCTCTTCAGAGCCAGCAGG - Intergenic
982489189 4:156007028-156007050 CTAATTTCCCCATAGCCATGGGG + Intergenic
984325047 4:178241415-178241437 CTGTGCTCCACAGAGCCAGTGGG + Intergenic
984563712 4:181301917-181301939 CTCTTCACCCCAACGCCAGGTGG + Intergenic
984580695 4:181506614-181506636 CTGTTCTGCCCAAATCCAGGAGG - Intergenic
985937374 5:3107261-3107283 CAGTTCCACCCAGAGCCAGGGGG + Intergenic
986753552 5:10812325-10812347 CTAGGCTCCCCAGAGCCAGCAGG - Intergenic
987200930 5:15577312-15577334 CTATTGTCCCCAGGGGCAGGGGG + Intronic
990384087 5:55242592-55242614 CTGTAGTCCCCAGAGGCAGGAGG - Intergenic
992129215 5:73674710-73674732 CTCTTCTCCCCAGAGGTTGGGGG - Intronic
995258258 5:110072458-110072480 CTAGACTCTCCAGAGCCAGCAGG + Intergenic
995522951 5:113028031-113028053 CTGTTCCCACCAGAGCCTGGTGG + Intronic
998702988 5:144725997-144726019 CTATTCTTCCAAGAGTAAGGTGG + Intergenic
1000719917 5:164693509-164693531 CCAGTCTCCTCAGAGCCAGCAGG - Intergenic
1000860372 5:166450071-166450093 CTACTCTCTTCAGAGCCAGCAGG + Intergenic
1002328554 5:178426013-178426035 CTATTCTCTCCACAGCAGGGGGG + Intronic
1002977385 6:2095114-2095136 CTATTATCCCCAAAATCAGGTGG + Intronic
1005104771 6:22212775-22212797 CTACTGGCCTCAGAGCCAGGTGG - Intergenic
1006788013 6:36680618-36680640 CTATTCCCGCCAGGGCCGGGAGG - Intronic
1006915406 6:37590863-37590885 CTATTCTCATCACAGCCAGAGGG + Intergenic
1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG + Intronic
1007763949 6:44150216-44150238 CTGTTCTCCCCAGAGCTGGAGGG - Exonic
1010043169 6:71410909-71410931 CTTTCCTCCCCAGAGACAAGAGG - Intergenic
1011298887 6:85853428-85853450 CTGTTCTCTTCAGAGCCAGCGGG + Intergenic
1012854367 6:104484434-104484456 CTGTTCTCTCCACAGGCAGGAGG + Intergenic
1014430846 6:121368822-121368844 CTGTTCTCTCCAGAGCCGGCAGG - Intergenic
1014564396 6:122930399-122930421 CTAGACTCCCCAGAGCCAGCAGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1019443915 7:1061120-1061142 CTATCCTCCCCAAAGGCAGGAGG + Intronic
1020338934 7:7088819-7088841 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
1021014527 7:15516842-15516864 CTGCTCTCTCCAGAGCCAGAAGG - Intronic
1021805690 7:24352735-24352757 CTGTTCTCTTCAGAGCCAGCAGG - Intergenic
1022347776 7:29533856-29533878 CTATTCTAACCAGAGTGAGGTGG - Intergenic
1022392446 7:29955280-29955302 TTCTGCTCCCCAGAGCCAGGCGG + Exonic
1024937680 7:54727958-54727980 CTATCCTCCTCAGAGCATGGTGG - Intergenic
1026741450 7:72981202-72981224 TCATTCTCCCCAGGGCCAGAGGG + Intergenic
1026801287 7:73401572-73401594 TCATTCTCCCCAGGGCCAGAGGG + Intergenic
1026824026 7:73570233-73570255 CCATTCTCCTCAGTGCCAGGTGG + Exonic
1027102285 7:75383876-75383898 TCATTCTCCCCAGGGCCAGAGGG - Intergenic
1028317288 7:89419357-89419379 CTGTTCTTGCCAGAGACAGGAGG + Intergenic
1031011811 7:116532454-116532476 CAACTTTCCCCACAGCCAGGGGG - Intronic
1037519150 8:19662840-19662862 CTATTCTCCCCCCATTCAGGAGG + Intronic
1037781500 8:21872377-21872399 CTCATGGCCCCAGAGCCAGGAGG - Intergenic
1038459374 8:27703145-27703167 TTTTTCTCCCCAGAGCCTTGTGG - Intergenic
1043642428 8:82471805-82471827 CTCTTATCCCCAGAGCCACAGGG - Intergenic
1045320622 8:101079432-101079454 CTATATTCCCCAAAGGCAGGAGG - Intergenic
1045688770 8:104738910-104738932 CTATTCTCCCAAGACACAGAGGG - Intronic
1048107008 8:131421841-131421863 CTAATTTCCCCAAAGCCACGAGG - Intergenic
1048915118 8:139175282-139175304 GTCTTCTCTCCAGAGCCATGGGG + Intergenic
1049776470 8:144408149-144408171 CTATTCTCCACAAAGCAGGGAGG - Intronic
1051344643 9:16141036-16141058 CTATTCTCACCAGCTCCATGAGG - Intergenic
1053174726 9:35914531-35914553 CTATTGTCCCCAAGGGCAGGAGG + Intergenic
1054719825 9:68593690-68593712 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG + Intronic
1056799833 9:89683356-89683378 CTCTTAGCCCCAGAGCCAGAGGG + Intergenic
1060303715 9:122392087-122392109 CTATTATCCCCAGAAAAAGGTGG + Intronic
1061864351 9:133484872-133484894 CCATGCTCCCCAGGGACAGGCGG - Intergenic
1061971133 9:134046093-134046115 CTCTGCTTGCCAGAGCCAGGTGG - Intronic
1062071723 9:134559168-134559190 CCAACCTCCCCAGACCCAGGAGG - Intergenic
1062479734 9:136745737-136745759 CTCCGCTCCCGAGAGCCAGGAGG - Intronic
1186051060 X:5596142-5596164 TTATTTTCCCCAGAGCCTAGTGG - Intergenic
1186181267 X:6975756-6975778 CTGTTCTCTTCAGAGCCAGCAGG + Intergenic
1186779192 X:12896195-12896217 CAATTATACCCAGAGTCAGGAGG - Intergenic
1192217978 X:69177241-69177263 CTCTTCTCCCCAGAGCCAGGAGG + Intergenic
1192226168 X:69229478-69229500 CAATTCTGCCCAGAGGCAGGGGG + Intergenic
1193034530 X:76934824-76934846 CTGCTCTCCTCAGAGCCAGCTGG - Intergenic
1193040404 X:76998524-76998546 CTGTTCTCCTCAGAGCCCGCAGG + Intergenic
1193074597 X:77342112-77342134 CAAGTGTCCCAAGAGCCAGGTGG - Intergenic
1193253969 X:79325205-79325227 CTGCTCTCTTCAGAGCCAGGAGG + Intergenic
1195434640 X:104828671-104828693 CTGTTCTCTTCAGAGCCAGCAGG + Intronic
1195833679 X:109088802-109088824 CTACTCTCTTCAGAGCCAGCAGG + Intergenic
1196312436 X:114184079-114184101 CTACTCTCTTCAGAGCCAGCAGG - Intergenic
1197455255 X:126670868-126670890 CCATACTCTCCAGAGCCAGCAGG - Intergenic
1197614245 X:128674556-128674578 CTGGTCTCCTCAGAGCCAGCAGG + Intergenic
1198786367 X:140292528-140292550 CTGTACTCCCCAGAGCCAGCAGG + Intergenic