ID: 1007420041

View in Genome Browser
Species Human (GRCh38)
Location 6:41713720-41713742
Sequence CTATTCTCCCCAGAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007420038_1007420041 -3 Left 1007420038 6:41713700-41713722 CCCTTTGCATGAATCATTTTCTA No data
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420036_1007420041 13 Left 1007420036 6:41713684-41713706 CCAAAACAGGGAGGGCCCCTTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420037_1007420041 -2 Left 1007420037 6:41713699-41713721 CCCCTTTGCATGAATCATTTTCT No data
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420031_1007420041 26 Left 1007420031 6:41713671-41713693 CCTCAGGCTGTGGCCAAAACAGG 0: 1
1: 0
2: 2
3: 23
4: 213
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222
1007420039_1007420041 -4 Left 1007420039 6:41713701-41713723 CCTTTGCATGAATCATTTTCTAT 0: 1
1: 0
2: 2
3: 33
4: 417
Right 1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG 0: 1
1: 1
2: 0
3: 27
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007420041 Original CRISPR CTATTCTCCCCAGAGCCAGG AGG Intronic