ID: 1007423408

View in Genome Browser
Species Human (GRCh38)
Location 6:41733264-41733286
Sequence TGGTGACTCACAGTCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007423408_1007423413 5 Left 1007423408 6:41733264-41733286 CCACCTCTGACTGTGAGTCACCA 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1007423413 6:41733292-41733314 TTAGCCCGTAAAAGCCCAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007423408 Original CRISPR TGGTGACTCACAGTCAGAGG TGG (reversed) Intronic