ID: 1007423408

View in Genome Browser
Species Human (GRCh38)
Location 6:41733264-41733286
Sequence TGGTGACTCACAGTCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007423408_1007423413 5 Left 1007423408 6:41733264-41733286 CCACCTCTGACTGTGAGTCACCA 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1007423413 6:41733292-41733314 TTAGCCCGTAAAAGCCCAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007423408 Original CRISPR TGGTGACTCACAGTCAGAGG TGG (reversed) Intronic
900720127 1:4170537-4170559 GGGTGACTCACAGACAGCTGAGG + Intergenic
901399477 1:9006121-9006143 AGGTGACACACAGGCAGTGGGGG + Intronic
904325718 1:29726718-29726740 AGGTGGCTCCCAGTCAGATGTGG + Intergenic
904373831 1:30066969-30066991 AGGTGGCTCCCAGTCAGATGGGG - Intergenic
905310175 1:37043564-37043586 TGGTGACCCACTGTCACAGGGGG + Intergenic
906789482 1:48646091-48646113 TGCTGTCTCACAGTCAGAGGTGG + Intronic
907924607 1:58943987-58944009 AGGTGACTGAGAGTCAGAGAGGG + Intergenic
910613813 1:89174681-89174703 TGCTGATGCACAGTGAGAGGAGG - Intronic
910745827 1:90573853-90573875 AGGTGCCTCACAGGCAGAAGAGG - Intergenic
911064465 1:93775433-93775455 TGGTGAGTCACAGTGTGATGCGG + Intronic
912624312 1:111194950-111194972 TGGTGAAGCACAGTGAGAGAGGG - Intronic
915881482 1:159677042-159677064 TGGTGAGTCAGATTCAGATGTGG - Intergenic
916499461 1:165374526-165374548 TGGTGACTGACAGCCAGAAAGGG - Intergenic
916600856 1:166291942-166291964 TGGCGACTAACTGTCAGAGAGGG + Intergenic
917259364 1:173150235-173150257 TGGGGACTGACTTTCAGAGGAGG - Intergenic
918072079 1:181140514-181140536 TTCTGACTCAGAGGCAGAGGAGG + Intergenic
918150416 1:181793770-181793792 TGGGGATCCACAGTCAGACGTGG - Exonic
918276297 1:182956305-182956327 TGTAGACTCATGGTCAGAGGTGG - Intergenic
918349587 1:183640203-183640225 TGGATACTCAAAGTCAGAGTTGG + Intronic
922338182 1:224634612-224634634 TGGTGTCTCCCAGTCAGTGCAGG + Intronic
923386802 1:233472961-233472983 TGGAAAATCACAGTCAAAGGGGG + Intergenic
924389342 1:243535376-243535398 TGGAGACTCAGAGTGAGGGGAGG - Intronic
924604670 1:245522468-245522490 TGGGGACACACTGTCAGAGGAGG + Intronic
1063300845 10:4847636-4847658 AGGAGCCACACAGTCAGAGGGGG + Exonic
1063318872 10:5033646-5033668 TGTTGACTCACAATAAGTGGTGG - Intronic
1067036857 10:42927216-42927238 AGTAGACTCACATTCAGAGGTGG - Intergenic
1067803919 10:49380307-49380329 TGGAGAGCCACAGTCAGCGGAGG - Intronic
1071076275 10:81756971-81756993 TTGTGACTTACAGTCAAACGAGG - Intergenic
1072493602 10:95933682-95933704 TGGTGACACCCAGGCAAAGGGGG - Intronic
1072950849 10:99845537-99845559 TGGGCATTCACAGTCACAGGAGG - Intronic
1075466489 10:122655335-122655357 GGGGGACAGACAGTCAGAGGGGG + Intergenic
1075487293 10:122834729-122834751 TGGAGATGCAAAGTCAGAGGTGG + Exonic
1077083949 11:738256-738278 TTGTGACCCACAGTCAGACAAGG + Intergenic
1077128637 11:957478-957500 TTGTGACCCACAGTCAGACAAGG + Intronic
1078019142 11:7640842-7640864 TGGTGACTGACACTGAGAAGAGG - Intronic
1080442171 11:32304983-32305005 TGCTGATTCACAGTCAGATTTGG - Intergenic
1080965974 11:37215859-37215881 TGAAAACACACAGTCAGAGGAGG - Intergenic
1081783181 11:45727668-45727690 TGGTCTGTCACAGTAAGAGGTGG - Intergenic
1085314667 11:75537271-75537293 TGCTGACTCAGAGTCACAGTGGG + Intergenic
1090535578 11:127637611-127637633 TGGTGTCTGATAGTCAGAGAAGG + Intergenic
1091154981 11:133363717-133363739 TGGTCACGCACAGTGGGAGGGGG - Intronic
1091705894 12:2693145-2693167 TGGTCTCTCACAGCAAGAGGCGG - Intronic
1097498448 12:60373332-60373354 TGGAGACTCAGAGACAGTGGTGG - Intergenic
1098167202 12:67710710-67710732 TGGTGACTCAGAATGAGAGGAGG + Intergenic
1101758791 12:107642424-107642446 TGGGGACTCAGAGTCTGTGGGGG + Intronic
1103318447 12:120075814-120075836 TGGTCACTCACAGAAAGAAGAGG - Intronic
1103505697 12:121441250-121441272 TGGGGACACATCGTCAGAGGTGG + Intronic
1103862593 12:124026501-124026523 AGGTGGCTTAGAGTCAGAGGAGG - Intronic
1105779006 13:23690211-23690233 TGGTGAGTGACACTGAGAGGCGG - Intergenic
1107642647 13:42459729-42459751 AGGTGAATCAGAGACAGAGGAGG + Intergenic
1107647467 13:42509804-42509826 AGGTGAATCAGAGGCAGAGGAGG - Intergenic
1108417109 13:50209071-50209093 TGCTGACTCACAGACACAGCCGG - Intronic
1108679859 13:52770519-52770541 TTTTTCCTCACAGTCAGAGGCGG - Intergenic
1110736887 13:78947747-78947769 TAGTGATTCCCAGCCAGAGGAGG + Intergenic
1112179366 13:97062378-97062400 TGGTGAGAGACAGGCAGAGGAGG + Intergenic
1113381753 13:109811427-109811449 TGGGGACACACAGCCAGAGGAGG - Intergenic
1113381770 13:109811479-109811501 AGGGGACACACAGCCAGAGGAGG - Intergenic
1113381788 13:109811531-109811553 TGGGGACACACATCCAGAGGAGG - Intergenic
1113395100 13:109940164-109940186 GGCTGACTGAGAGTCAGAGGAGG + Intergenic
1113652140 13:112041519-112041541 TGGGGACTCTGAGTCCGAGGAGG - Intergenic
1115125636 14:29989657-29989679 TAGTGACCCACAGACAAAGGAGG - Intronic
1115439349 14:33414248-33414270 TGCTGACTCACAGTGGGGGGAGG - Intronic
1120513490 14:85443176-85443198 TGATGACTCAGAGTTAGAAGAGG + Intergenic
1126790816 15:52219487-52219509 TGGTGACTGATACACAGAGGAGG - Intronic
1129691443 15:77715932-77715954 TGGTGTCTCACGGTCAGCTGAGG + Intronic
1131408737 15:92188186-92188208 AAGTGACTCCCAGTCAGAGAAGG + Intergenic
1132073332 15:98798708-98798730 TGGTGAGTGACAGGCAGAGAGGG + Intronic
1132624920 16:887121-887143 TGGTGACCCACAGTCTGAGCGGG + Intronic
1132909008 16:2298996-2299018 TGGGTATTCACAGACAGAGGCGG + Intronic
1133299797 16:4775386-4775408 AGGTGACACACACTCAGAGGGGG + Intergenic
1133519445 16:6542917-6542939 TGCTGAGTCACAGTTAGAAGGGG + Intronic
1137845695 16:51685746-51685768 AGGAGACGCAAAGTCAGAGGAGG - Intergenic
1140317923 16:73917388-73917410 TGGAAATTCACAGCCAGAGGAGG + Intergenic
1140761262 16:78111092-78111114 AGTGGACTCACACTCAGAGGAGG - Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1143023718 17:3929317-3929339 GGGTGACTCACAGGCAGGGGCGG + Exonic
1144027970 17:11295401-11295423 TGGCAACTTACAGTCAGTGGGGG + Intronic
1145779993 17:27556695-27556717 AGAAGACTCAGAGTCAGAGGAGG + Intronic
1146393666 17:32444713-32444735 TGCTGACTCACTGTGTGAGGGGG + Intronic
1146454568 17:32998879-32998901 TGGTGACTCTTAGGGAGAGGAGG + Intergenic
1147582436 17:41634930-41634952 TGGAGACTCCCAGTCAGAGGAGG + Intergenic
1150633555 17:66897348-66897370 TGGTGACTCACAGCTGGCGGGGG - Intergenic
1151331308 17:73410849-73410871 TGGTGACCCAGAGCAAGAGGAGG - Intronic
1153703702 18:7723523-7723545 TGGGCACTGACAGTCAGTGGAGG - Intronic
1154410059 18:14135062-14135084 TAATGACTCACATTCATAGGTGG + Intergenic
1155176757 18:23307815-23307837 TGGGGACTCAGAGTCCCAGGAGG - Intronic
1160029030 18:75242734-75242756 TGGTGACTTAAAGTGAGAGAGGG + Intronic
1161207566 19:3049307-3049329 TGGTGGGTGAGAGTCAGAGGAGG + Intergenic
1161302397 19:3548940-3548962 TGGTGATACACAGGCAGATGTGG + Intronic
1161389974 19:4015755-4015777 CGGTGGGTCACAGCCAGAGGAGG - Intronic
1162592448 19:11601204-11601226 TGGGGATTCATAGGCAGAGGTGG + Intronic
1167260452 19:48455044-48455066 TAGAGACTCAGAGACAGAGGGGG - Exonic
1168470008 19:56632114-56632136 TGGTGGCTAACAGCCAGATGTGG + Intergenic
925318520 2:2943032-2943054 TGGTGACTCAGAGTCCCAAGAGG - Intergenic
925349364 2:3190122-3190144 GGGTAACTCACAGTCAAGGGAGG - Intronic
925399684 2:3563375-3563397 TGGTGCCTCAGAGTCAGCTGGGG - Intergenic
931119582 2:59201183-59201205 TGATGACTCAGAGACACAGGTGG + Intergenic
935359469 2:102235336-102235358 TGGTGGCTCACAGCTGGAGGAGG + Intronic
936018756 2:108979140-108979162 TGGAGAAACACAGTGAGAGGAGG - Intronic
937080471 2:119136550-119136572 TGGTGACACACAGCTAGAAGTGG - Intergenic
937316469 2:120934926-120934948 TGGTGAGTCACAGGCTGAGCAGG - Intronic
937508547 2:122565762-122565784 GGCTGACTCACAGTCAGAACAGG + Intergenic
939221848 2:139311804-139311826 TGGTGACACAGAGACAGAGACGG - Intergenic
943083238 2:183281789-183281811 TGGTGAGTCACAGGCATAGGAGG + Intergenic
943509681 2:188809080-188809102 TGGTGACTCACATTCCCAGTGGG + Intergenic
946878276 2:224151837-224151859 AGGAGAGTCAGAGTCAGAGGAGG + Intergenic
947528305 2:230893062-230893084 GGGTGACTCACAGGAAGAAGAGG - Intergenic
948117962 2:235507641-235507663 TGGTCACTGCCAGACAGAGGTGG + Intronic
948866366 2:240776877-240776899 TTGAGACTCCCAGTCAAAGGGGG + Intronic
1168730803 20:79350-79372 AGGTGACTCAGATCCAGAGGTGG + Intergenic
1168980082 20:1996592-1996614 TGGTGAATAACAGTCAGGAGAGG - Intergenic
1173414576 20:42844555-42844577 TGGTTACTCACAGTGACAGAAGG + Intronic
1173937021 20:46875453-46875475 TTGTGACACACAATCAGAGGGGG + Intergenic
1174471329 20:50763258-50763280 TGGTGACGCCCAGGCAAAGGGGG - Intergenic
1175189238 20:57199914-57199936 TGGTGTCCCGGAGTCAGAGGGGG + Intronic
1176863004 21:14023349-14023371 TAATGACTCACATTCATAGGTGG - Intergenic
1176936910 21:14877859-14877881 AGTTGAGTCACAGTCTGAGGTGG + Intergenic
1180840444 22:18956626-18956648 TGATGTCTCACAGTGAGGGGCGG + Intergenic
1181366201 22:22378784-22378806 TTGTGACTCACAGGAGGAGGAGG + Intergenic
1182883405 22:33753265-33753287 AGGAGAGTCACAGTCAGAGAAGG + Intronic
1185264357 22:49891894-49891916 TGCTGCCTCATAGTCAGAAGTGG - Intergenic
950420945 3:12899215-12899237 AGGTGACACACAGCCAGAGGGGG + Exonic
950462525 3:13133961-13133983 TGATGACTCTCAATCTGAGGAGG + Intergenic
950675313 3:14550932-14550954 TGGTGACTCATAAGCAGATGTGG - Intergenic
952964690 3:38613881-38613903 AGGAGACACACAGTCAGAGGAGG + Intronic
953126390 3:40095230-40095252 TGGGAAGTCAGAGTCAGAGGAGG - Intronic
953708830 3:45252429-45252451 TCGTGACTTACAGTCAGAAAGGG + Intergenic
955524000 3:59802564-59802586 TGGAAAATCACAGTCAAAGGGGG - Intronic
957258295 3:77867206-77867228 TGGTGTCTATCAGTCAGAGTTGG - Intergenic
960510613 3:118544732-118544754 TGGATACTCAAGGTCAGAGGCGG + Intergenic
960750443 3:120945730-120945752 TGGAGACTCAAAGCCAGAGTTGG + Intronic
960977293 3:123187716-123187738 TGGTCTCCCACAGTAAGAGGAGG + Intronic
962188345 3:133284071-133284093 TGGTGCTTCAGGGTCAGAGGAGG + Intronic
962791619 3:138816708-138816730 TGGTGACTCACAGTGAGGGTAGG - Intronic
965399112 3:168196783-168196805 TGATTAATCACAGTCAGAGAAGG - Intergenic
966596807 3:181731419-181731441 TAGGGACTCAAAGTCAGAGTTGG - Intergenic
966761717 3:183425315-183425337 AAGTGACTCAGGGTCAGAGGAGG + Intronic
967248888 3:187516936-187516958 GGGTGACACAGAGTCACAGGAGG - Intergenic
967438783 3:189481904-189481926 TGGAAACTCACAGTCAGGAGGGG + Intergenic
970434061 4:16015828-16015850 AGCTGACTCACTGGCAGAGGGGG + Intronic
971713648 4:30148947-30148969 TGGAAAATTACAGTCAGAGGGGG + Intergenic
972212156 4:36851826-36851848 TGGTCACTTTCAGTCAGAGAAGG + Intergenic
973053315 4:45622096-45622118 AGGAGAGTCACAGTCAGAGAAGG + Intergenic
973634621 4:52850649-52850671 CTGTGACTCACAGGTAGAGGAGG - Intergenic
976339999 4:83936307-83936329 TGGTTACCTAGAGTCAGAGGTGG + Intergenic
976364510 4:84218150-84218172 TGGAGGCTCACAGACAAAGGAGG + Intergenic
979600061 4:122577505-122577527 TGGGGACTCACAGACAGACGAGG + Intergenic
981477720 4:145204600-145204622 GGGTGACTGACATACAGAGGGGG + Intergenic
982039871 4:151386356-151386378 TATAGACTCACATTCAGAGGCGG + Intergenic
984316533 4:178138029-178138051 AGGTGACTCACATGCAGATGTGG + Intergenic
986319763 5:6620680-6620702 GCCTGACTCACAGTCAGAGCAGG - Intronic
986896535 5:12377453-12377475 TGCAGACTCACAGTGAGGGGAGG - Intergenic
987631080 5:20472642-20472664 TGGTGATTCCCAGGCAGATGTGG - Intronic
990133785 5:52620509-52620531 TGGTGAACCACAGGCTGAGGTGG - Intergenic
990638724 5:57758859-57758881 TGGTGGCTCACAGTTTTAGGAGG + Intergenic
991946845 5:71906416-71906438 TGATCACTCACAGTCAGGGTTGG + Intergenic
992884156 5:81141110-81141132 TGGTGGCTCACAGCCAAATGTGG - Intronic
995207927 5:109503837-109503859 TGGTGCCTGACTGTCTGAGGAGG + Intergenic
998605485 5:143629957-143629979 TGGTGACTTCCTGTCAGAGCAGG + Intergenic
999243786 5:150142424-150142446 TGGCGACTGAGACTCAGAGGAGG + Intronic
1001575082 5:172758032-172758054 AGGTGGCTCACAGTCAGGTGAGG + Intergenic
1001663709 5:173415569-173415591 TGCTAAGTCACAGTCAGGGGAGG - Intergenic
1002889672 6:1321309-1321331 TGGTGACACACACTTACAGGTGG + Intergenic
1007423408 6:41733264-41733286 TGGTGACTCACAGTCAGAGGTGG - Intronic
1010066931 6:71693436-71693458 TGGTGGCTAAAAATCAGAGGTGG + Intergenic
1012950532 6:105513345-105513367 TGTTGACCTACAGTCATAGGTGG + Intergenic
1015162323 6:130167299-130167321 TGGTTTCCTACAGTCAGAGGTGG + Intronic
1017180820 6:151550335-151550357 TGGTGGCCCACAGGCTGAGGAGG + Intronic
1018559275 6:165084733-165084755 TGGTAGCTCACAGTGAGTGGTGG - Intergenic
1018610239 6:165641570-165641592 TGATAACCCACAGTCAGAGCGGG + Intronic
1019570690 7:1710628-1710650 TGGTGATTCAGAGTCAGATCGGG + Intronic
1019999070 7:4744673-4744695 CGGGGACTCGCAGTCACAGGAGG - Intronic
1020219754 7:6226653-6226675 TGCTGACTGAGAGTCAGAGTTGG - Intronic
1021172399 7:17414322-17414344 TGGAAAATCACAGTCAAAGGGGG - Intergenic
1024101252 7:46035152-46035174 TGGTGAGTTTCAGTTAGAGGTGG - Intergenic
1024610127 7:51057069-51057091 AAGTGACTCACAGGCAGGGGAGG - Intronic
1027840312 7:83302269-83302291 TGTTGAGTCACAACCAGAGGAGG - Intergenic
1029272971 7:99387986-99388008 TGATGACACTCAGGCAGAGGTGG - Intronic
1032794674 7:135268275-135268297 AGGTGCCTGACAGTCAGTGGTGG + Intergenic
1036152647 8:6312990-6313012 TGGAGGGTCACAGTCAGAGAAGG + Intergenic
1037979753 8:23243641-23243663 TGCTGCATAACAGTCAGAGGAGG - Exonic
1039084244 8:33764072-33764094 TCTTGACTGACAGTCAGAAGCGG + Intergenic
1041195822 8:55400511-55400533 GGCTGACACACAGTGAGAGGAGG + Intronic
1045197138 8:99943950-99943972 TGGAAACTTACAGTCAAAGGGGG - Intergenic
1046046192 8:108967774-108967796 AGGTGATTCACAGTGAGAGCTGG - Intergenic
1047700921 8:127448552-127448574 AGGAGAGTCAGAGTCAGAGGAGG + Intergenic
1049283875 8:141764158-141764180 AGGAGACTGACAGACAGAGGAGG + Intergenic
1050161184 9:2719729-2719751 TGTGGACTCACAGCTAGAGGTGG + Intronic
1050851374 9:10291153-10291175 TAGAGACTCACAGACAGATGGGG + Intronic
1051681818 9:19615064-19615086 TTGTGACTCAGGCTCAGAGGCGG + Intronic
1053026182 9:34730133-34730155 TTGTGACCCACAGTCAGAAGCGG - Intergenic
1053364217 9:37511413-37511435 TGGGGACACACAGTCAGAAGTGG + Exonic
1056293080 9:85163609-85163631 TGATGACTCACAGTCAAATCAGG + Intergenic
1057718965 9:97517443-97517465 GGGTGACTGACAGGCAGAAGAGG + Intronic
1059214732 9:112550492-112550514 TAGTGAATCACAGCCTGAGGTGG - Intronic
1059530481 9:115030945-115030967 TTGTGAGTTACAGTCAGAGTTGG - Intronic
1060297183 9:122350761-122350783 TGGCCACTCACAGGCAGGGGAGG + Intergenic
1061724603 9:132575231-132575253 TGGCGAGTCTGAGTCAGAGGCGG + Intergenic
1185858923 X:3559881-3559903 TGGAGAATTACAGTCAAAGGGGG + Intergenic
1187274498 X:17805992-17806014 TGCTGACTCAGAGTCAGAGTGGG - Intronic
1190217117 X:48487318-48487340 GGGTGAGTCACAGTCAGGTGTGG - Intergenic
1192544314 X:72000717-72000739 TGGAGAGTCAGAGTCAGAGAAGG - Intergenic
1193508588 X:82372394-82372416 AGGTGACTCACACGCAGATGTGG - Intergenic
1195060596 X:101190593-101190615 TTGTGACTCCCAGACAGAGATGG + Intergenic
1197900379 X:131365332-131365354 TGGTAACTCAGTGTCAAAGGAGG - Intronic
1199714352 X:150495670-150495692 TGGGGACACAGAGTCAGAGAGGG + Intronic
1202093833 Y:21222769-21222791 TGGTGACTTAGAGTCTGTGGTGG + Intergenic