ID: 1007427578

View in Genome Browser
Species Human (GRCh38)
Location 6:41757363-41757385
Sequence GTAAGTCCCAGAGTGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007427578_1007427583 0 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427583 6:41757386-41757408 TGCTACAGCTCACAGGAGGGAGG No data
1007427578_1007427580 -7 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427580 6:41757379-41757401 GACTTACTGCTACAGCTCACAGG No data
1007427578_1007427584 1 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427584 6:41757387-41757409 GCTACAGCTCACAGGAGGGAGGG No data
1007427578_1007427581 -4 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427581 6:41757382-41757404 TTACTGCTACAGCTCACAGGAGG No data
1007427578_1007427585 25 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427585 6:41757411-41757433 CTGTTTCTCCCACAAGCTCTAGG No data
1007427578_1007427582 -3 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427582 6:41757383-41757405 TACTGCTACAGCTCACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007427578 Original CRISPR GTAAGTCCCAGAGTGGCACA AGG (reversed) Intergenic
No off target data available for this crispr