ID: 1007427579

View in Genome Browser
Species Human (GRCh38)
Location 6:41757370-41757392
Sequence TGTAGCAGTAAGTCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007427579_1007427584 -6 Left 1007427579 6:41757370-41757392 CCACTCTGGGACTTACTGCTACA No data
Right 1007427584 6:41757387-41757409 GCTACAGCTCACAGGAGGGAGGG No data
1007427579_1007427582 -10 Left 1007427579 6:41757370-41757392 CCACTCTGGGACTTACTGCTACA No data
Right 1007427582 6:41757383-41757405 TACTGCTACAGCTCACAGGAGGG No data
1007427579_1007427583 -7 Left 1007427579 6:41757370-41757392 CCACTCTGGGACTTACTGCTACA No data
Right 1007427583 6:41757386-41757408 TGCTACAGCTCACAGGAGGGAGG No data
1007427579_1007427585 18 Left 1007427579 6:41757370-41757392 CCACTCTGGGACTTACTGCTACA No data
Right 1007427585 6:41757411-41757433 CTGTTTCTCCCACAAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007427579 Original CRISPR TGTAGCAGTAAGTCCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr