ID: 1007427582

View in Genome Browser
Species Human (GRCh38)
Location 6:41757383-41757405
Sequence TACTGCTACAGCTCACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007427579_1007427582 -10 Left 1007427579 6:41757370-41757392 CCACTCTGGGACTTACTGCTACA No data
Right 1007427582 6:41757383-41757405 TACTGCTACAGCTCACAGGAGGG No data
1007427578_1007427582 -3 Left 1007427578 6:41757363-41757385 CCTTGTGCCACTCTGGGACTTAC No data
Right 1007427582 6:41757383-41757405 TACTGCTACAGCTCACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007427582 Original CRISPR TACTGCTACAGCTCACAGGA GGG Intergenic
No off target data available for this crispr