ID: 1007430747

View in Genome Browser
Species Human (GRCh38)
Location 6:41775383-41775405
Sequence CCTGCTCCACCCTGGGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430747_1007430757 10 Left 1007430747 6:41775383-41775405 CCCCTATCCCAGGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1007430757 6:41775416-41775438 CACCCTGGCCTGTCTGACATCGG 0: 1
1: 0
2: 0
3: 14
4: 203
1007430747_1007430762 26 Left 1007430747 6:41775383-41775405 CCCCTATCCCAGGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430747_1007430755 -5 Left 1007430747 6:41775383-41775405 CCCCTATCCCAGGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1007430755 6:41775401-41775423 GCAGGGCCTGGTACTCACCCTGG 0: 1
1: 0
2: 7
3: 38
4: 301
1007430747_1007430760 13 Left 1007430747 6:41775383-41775405 CCCCTATCCCAGGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1007430760 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430747 Original CRISPR CCTGCTCCACCCTGGGATAG GGG (reversed) Intronic
900077667 1:830997-831019 CGTTCTCCAGCCTGGGACAGAGG + Intergenic
900189083 1:1345756-1345778 CCTGCTCCGCCTTGGGAGAATGG - Intronic
900623629 1:3598505-3598527 ACTGCTGCAGCCTGGGAGAGGGG - Intronic
900625890 1:3608386-3608408 CCTTCTACACCCTGGGGTCGGGG + Intronic
900890282 1:5444586-5444608 GCTGCTCCACCATGCGACAGAGG + Intergenic
901131536 1:6964521-6964543 CTTTCTCCAACCTGGGAGAGAGG - Intronic
902331177 1:15731877-15731899 ACTGCTCCCCCCTGGGCCAGAGG - Exonic
902360590 1:15940828-15940850 CCTGCTTCACACTGGGAGAAGGG - Intergenic
903778492 1:25807913-25807935 CCTGCCCCACCCTGGGCAAAAGG - Intronic
904498844 1:30902572-30902594 CCTGCTCCCTGCTGGGACAGGGG + Intronic
905630296 1:39514763-39514785 CCGGCTCCGCCCTGGGCTGGGGG - Intronic
905632539 1:39526685-39526707 CCTTCTCCTGCCTGGGAAAGAGG + Intergenic
905667463 1:39771426-39771448 CCGGCTCCGCCCTGGGCTGGGGG + Intronic
906246812 1:44282067-44282089 CCTGCTCCACTCTGCTACAGGGG + Intronic
907334089 1:53689100-53689122 CCTGCCCCACCCTGTGAGGGTGG - Intronic
908772654 1:67610402-67610424 CTTGCTCCAGCCTGGCATGGAGG + Intergenic
912380246 1:109243699-109243721 CCTGCTGCAGCCAGGGGTAGAGG - Intergenic
921080998 1:211738321-211738343 CCCGCTCCACCCTGGGCTGTAGG + Intergenic
923464272 1:234234351-234234373 CCGGCTTCACCCTGGGGAAGCGG - Intronic
1067077192 10:43194910-43194932 CCTGCTCCACCCAGGACCAGAGG + Exonic
1069042966 10:63713591-63713613 CCTGCCACAGCCTGGGAGAGGGG + Intergenic
1069635743 10:69923790-69923812 CCTGCTTCTCCCTGGGGAAGAGG - Exonic
1069786960 10:70994608-70994630 CCTTCTGCAGCCTGGGACAGGGG + Intergenic
1073207894 10:101778369-101778391 CCTGCCCCTCCCTGGAATGGGGG + Intronic
1073292304 10:102419321-102419343 CCTGCTGCATCCTGGGAGGGTGG - Intronic
1074107851 10:110401806-110401828 CCTGCTCCATCCAGGGCCAGAGG - Intergenic
1075129634 10:119726554-119726576 TCTGCTCCGCACTGGGGTAGGGG - Intronic
1076865354 10:133163891-133163913 CCTCCTCCCACCTGGGATGGGGG + Intronic
1076865373 10:133163945-133163967 CCTCCTCCCACCTGGGATGGGGG + Intronic
1076865409 10:133164053-133164075 CCTCCTCCCACCTGGGATGGGGG + Intronic
1077298700 11:1837652-1837674 CCTGCTTGACCCTCGGGTAGGGG + Intergenic
1078509603 11:11975663-11975685 CCTGGTTCACCCAGGGCTAGGGG + Intronic
1081604886 11:44520828-44520850 CCTGCTCCATCCTGGCAGTGCGG + Intergenic
1082118815 11:48356409-48356431 CCTGCCTCACACTGGGGTAGGGG + Intergenic
1084630632 11:70346249-70346271 CCTGCTCCTCCCTTGGATTCAGG - Intronic
1085020479 11:73203937-73203959 CCTTCCCCACCCTGGGTCAGAGG + Intergenic
1088598442 11:111456472-111456494 CCTGCTCAGCCCTGGGCTGGGGG - Intronic
1089172928 11:116527798-116527820 CCTGCTCCAATCTGGGAGTGGGG + Intergenic
1089645390 11:119875571-119875593 GCTTCTCCTCACTGGGATAGGGG - Intergenic
1089694785 11:120210509-120210531 CCTGCCCCACACTGGGAGGGTGG - Intergenic
1092537578 12:9403494-9403516 CCTCCTCCCCCCTGCGATGGGGG - Intergenic
1092538731 12:9406876-9406898 CCTCCTCCTCCCTGCGATGGGGG - Intergenic
1094160736 12:27387401-27387423 CCTTCTCCCCACTGGGATATGGG + Intronic
1095929444 12:47610881-47610903 CCTGCTCTACTCTGTAATAGAGG + Intergenic
1100449692 12:94694060-94694082 CCAGCCCCACCCTGGCATAAGGG + Intergenic
1102565302 12:113793609-113793631 CCTGCTCCACCCAGCTACAGGGG + Intergenic
1102652230 12:114450028-114450050 CCTGCTCCGCCCGGGGAAGGAGG - Intergenic
1103226951 12:119295944-119295966 CCTGCTCCCCCCAGGGACTGTGG - Intergenic
1103363301 12:120366703-120366725 CGTCCTCCAGCCTGGGAAAGGGG - Intronic
1106900838 13:34353463-34353485 CATGCTCTAACCTGGGATAAGGG + Intergenic
1116257811 14:42579864-42579886 CCAGATACACCCTGGGATATTGG - Intergenic
1117100246 14:52338560-52338582 CATCCTCCACCCTGGTGTAGGGG + Intergenic
1119434512 14:74589290-74589312 CCTGCCTCAGCCTGGGTTAGAGG - Intronic
1119650236 14:76377867-76377889 CCCACTCCACCCTGGGGCAGAGG + Intronic
1119768648 14:77206382-77206404 CCTGCTCCACCCCAGGTCAGTGG - Intronic
1119925144 14:78486562-78486584 CCTCTCCCACCCTGGGATGGTGG + Intronic
1120200449 14:81533338-81533360 CTTCCTCGACCCTGGGGTAGAGG - Intronic
1120423321 14:84315765-84315787 CCTGCGCCACCCTAGCAGAGGGG + Intergenic
1120657944 14:87217965-87217987 CCTGCTCCTCTCTGGGTTGGGGG - Intergenic
1122918660 14:104870618-104870640 CCTGCTTCTCCCTGGGGTAGGGG + Intronic
1124700106 15:31905255-31905277 CCTTCTCCACACTGGGAGAAGGG - Intergenic
1127291091 15:57571815-57571837 CCTGCTCCAGCCTGGACTGGTGG - Intergenic
1128662123 15:69509309-69509331 CCTGCTCCACAATGGCCTAGTGG - Intergenic
1128701702 15:69809374-69809396 CCTGCTCCACCCAAAGAGAGGGG - Intergenic
1129177991 15:73853885-73853907 TCTGCTCCAGCCAGGTATAGAGG - Intergenic
1129245660 15:74277344-74277366 CCTGCTCTGCCCAGGCATAGTGG - Intronic
1129335768 15:74851259-74851281 GCTGCTCCTCCCTGGTATACAGG - Intronic
1129665287 15:77576216-77576238 CCTGCTCCTCCCTGGCAGTGAGG - Intergenic
1131143877 15:89999801-89999823 TCTGCTCCTCCCTGGGAGAAGGG + Intergenic
1131699414 15:94918067-94918089 CCAGCTCCCTCCTGGAATAGAGG - Intergenic
1132104263 15:99051405-99051427 TTTGCCCCACCCTGGGATAGTGG + Intergenic
1132156833 15:99501790-99501812 GCTGCGCCACCCTGGGAAACTGG + Intergenic
1132585205 16:703168-703190 CCTGCTGGGCCCTGGGCTAGTGG + Intronic
1132667778 16:1089935-1089957 TCTGCTCCTGGCTGGGATAGCGG - Intergenic
1133708622 16:8379570-8379592 CCTTCTCCATCCTGGGGGAGAGG + Intergenic
1135991906 16:27223528-27223550 CCTGCTCCACCCTGGGTTTATGG + Intergenic
1136064895 16:27751974-27751996 CCTGCTCTACTCTGAGTTAGGGG - Intronic
1137270391 16:46899293-46899315 CCTGAGCCACACTGGGATTGAGG + Intronic
1138210613 16:55160010-55160032 CCTGCTCCAGCAGGGGACAGGGG - Intergenic
1138567799 16:57846202-57846224 CCAGCCCCACCCAGGGAGAGGGG - Intronic
1138654347 16:58482137-58482159 CCAGCTCTACCCTGGGGGAGGGG - Intronic
1138773022 16:59687503-59687525 CCTGCTCCACCATGTGAAAAAGG - Intergenic
1139215036 16:65119646-65119668 CCTCCTCACCCCTGGGAAAGGGG - Intronic
1139787921 16:69408792-69408814 CCTGCTCCTCTCTGTGAAAGTGG - Intergenic
1141158133 16:81610946-81610968 CCTGCTCCAGGGTGGGAGAGGGG + Intronic
1142167677 16:88601443-88601465 CCTGCTCCAGCCAGGGAAACTGG - Intronic
1142586197 17:975514-975536 CCTGCTCCAGCCAGGGGAAGTGG - Intronic
1142846900 17:2685797-2685819 CCTCCTCCACCCGGGGGAAGGGG - Intergenic
1143104227 17:4520355-4520377 CCTGCTCCACTGTGGGCAAGAGG + Intronic
1143149929 17:4801510-4801532 CCTCCTCAACCCTGGGTTGGGGG - Intergenic
1143176890 17:4960538-4960560 CCTTCTCCATCTTGGGAGAGGGG + Exonic
1143866382 17:9926640-9926662 CCTTCTCCACCGAGGCATAGCGG + Exonic
1146526746 17:33573220-33573242 CCTGCTCCAACCTGTGTTAAAGG + Intronic
1147594279 17:41706522-41706544 CATGATCCCCCCTGGGGTAGGGG - Intergenic
1147949843 17:44101116-44101138 CCTGCTCCAGCCGGGCACAGTGG + Intronic
1150295464 17:64005062-64005084 CCTCCTCTCCCCTGGGACAGAGG - Intronic
1150830250 17:68512445-68512467 CCCGCTCCACTCTGCGATAGCGG - Exonic
1151230909 17:72684451-72684473 CCTGCCCAAACCTGGGACAGTGG - Intronic
1151290599 17:73147174-73147196 CCTGCTCCAGCCTGGGAGTGGGG - Intergenic
1153103099 18:1497023-1497045 CCTGCTCCGAACTGGGAAAGAGG - Intergenic
1153604783 18:6821561-6821583 CCTTCTCCACCCTGGGGTGAAGG + Intronic
1154045919 18:10904685-10904707 CCTGCTCCATCCTGGGATCCAGG - Intronic
1155091478 18:22515407-22515429 GCTGCGCCTCCCTGGGACAGAGG - Intergenic
1156917621 18:42480262-42480284 CCTGGTCCACTCTGTGATGGTGG + Intergenic
1157396508 18:47346049-47346071 CCTGCTGCTCCTTGGGAAAGAGG + Intergenic
1160158519 18:76452150-76452172 GCGGCTGCTCCCTGGGATAGTGG - Intronic
1161285643 19:3467064-3467086 CCTCCTCCACCCAGGGATGACGG - Intronic
1161420930 19:4175594-4175616 CCAGCTCCAGCATGGGACAGTGG - Intronic
1163831268 19:19548212-19548234 CCTGCCCCACCCTAGGGAAGGGG - Intergenic
1164703689 19:30304025-30304047 GCTGCTCCATCCAGGGAGAGAGG - Intronic
1166215343 19:41331090-41331112 GCTGCTCCACCTTGGGCTTGCGG + Exonic
1166359994 19:42249097-42249119 CCTGCACTACCCTGGGCTGGTGG - Exonic
1167885262 19:52494751-52494773 CCTACCCCACCCTGGGAAAAGGG - Intronic
1167909156 19:52687901-52687923 CCTACCCCACCCTGGGAAAAGGG + Intronic
1167921171 19:52784488-52784510 CCTACCCCACCCTGGGAAAAGGG + Intronic
1168116258 19:54222696-54222718 CCTACTCCTCACTGGGACAGGGG - Intronic
925666841 2:6266066-6266088 CCTGCTCCACCCTCGGTTTTAGG - Intergenic
928647095 2:33366096-33366118 CCTCCTCCAAACTGGGAGAGGGG - Intronic
929823114 2:45289409-45289431 CCTCCTCCACCCTGGAACAATGG + Intergenic
929965344 2:46530346-46530368 CCTGACCTACCCTGAGATAGTGG - Intronic
932132193 2:69197710-69197732 CCTGGACCATCCTGGGACAGAGG - Intronic
933787999 2:85859118-85859140 CCTTCTCCACCCTGTGCTTGTGG + Intronic
935755871 2:106275918-106275940 CCTACTCCACCTTGGGGTGGAGG - Intergenic
937070850 2:119061947-119061969 ACTGCTCCACCCTGGGGTGGGGG + Intergenic
938246742 2:129782804-129782826 CCACCCCCACCCTGGGAGAGAGG - Intergenic
938681738 2:133699283-133699305 CCTGCTTTCTCCTGGGATAGAGG - Intergenic
940863640 2:158795393-158795415 CCTGCTCTCCCCTCGGAAAGGGG + Exonic
946354783 2:219177982-219178004 CCTGCCCCACACGGGGATACCGG + Exonic
947523473 2:230865245-230865267 CCTGCTCCACCCCGGGCTCTGGG - Intronic
948872822 2:240812201-240812223 CCTGCCTCACCCTGGGGTGGGGG + Intronic
948993728 2:241567849-241567871 GCTGCTCCACACTGGGAATGTGG - Intronic
1170464536 20:16610745-16610767 CCAGGTCCACCCAGGAATAGGGG - Intergenic
1172837535 20:37882632-37882654 CCGGCTCCACCTCGGGACAGTGG + Intergenic
1175989168 20:62779002-62779024 CCTTTTCCACCCTGGGATCCTGG + Intergenic
1176901568 21:14448461-14448483 CTAGCTCCACCTTGGGATGGTGG - Intergenic
1178978424 21:37240763-37240785 CCTTCTCCACCCTGGTATCCAGG - Intronic
1180606335 22:17061696-17061718 CCTGCTCCTGCCTGGGCCAGTGG + Intergenic
1181006182 22:20014768-20014790 CCTGCTCCACCCAGAGACCGGGG + Intronic
1181674237 22:24441457-24441479 CCTGCTCCATCCTGGGCCAGGGG - Exonic
1181922758 22:26333472-26333494 CCTGCTCCAACCTTGGGAAGGGG - Intronic
1183411230 22:37655871-37655893 CCTCGTCCACCCTGGGCTTGGGG + Exonic
1183414108 22:37672973-37672995 CCTCCTCCACCCTGGAAAATGGG - Intergenic
1183976465 22:41515260-41515282 CCAGTTCCATCCTGGGAGAGTGG + Intronic
1184143232 22:42592024-42592046 ACTGGTCCATCCTGGGGTAGCGG - Exonic
1184981838 22:48100723-48100745 GCTCCTCCACCCTGAGAAAGAGG + Intergenic
1185285185 22:49996895-49996917 CCTGCTTCCCCCGGGGATGGGGG + Intronic
950621917 3:14212778-14212800 CCTGCCCCAGGCTGGGATGGAGG + Intergenic
950672673 3:14536587-14536609 CCTCCTCCACACAGGGAGAGGGG + Intronic
952923771 3:38307058-38307080 CCTGCTCCACCCTGAGAGCTGGG - Intronic
954373548 3:50182840-50182862 CCTGCTCCAGCCAGGGCTTGGGG + Intronic
954433165 3:50482133-50482155 CCTTCTCCAGGCTGGGATGGGGG - Intronic
954773979 3:52999408-52999430 CCTGCCCCACCCTGGAATGCAGG - Intronic
956001175 3:64731519-64731541 ACTGCTCCACCCTTGGATCTGGG - Intergenic
958195741 3:90240016-90240038 CACACTCCAGCCTGGGATAGAGG + Intergenic
958839534 3:99186821-99186843 TTTGATCCACCCTGGGCTAGAGG + Intergenic
960742269 3:120847842-120847864 CCCACTCCACCCTGGGGTAGAGG + Intergenic
961181472 3:124881490-124881512 TCTGCTCCACCCAGGGATGTAGG + Intronic
961963781 3:130881076-130881098 CCTGCTGCACACTGGGATGTGGG - Intronic
962040125 3:131698197-131698219 TGTGCTCCAGCCTGGGAGAGGGG + Intronic
964339759 3:155696129-155696151 GCTGCTCCACACTAGGCTAGAGG + Intronic
965488719 3:169310901-169310923 CATGCAGGACCCTGGGATAGAGG - Intronic
966218461 3:177527055-177527077 CCCACTCCACCCTGGGGTAGAGG - Intergenic
966923856 3:184631821-184631843 CCTGCTCCATCCTGGAAAGGAGG + Intronic
968133179 3:196204023-196204045 CCTGCTCCACATTGTGCTAGAGG + Intronic
968658426 4:1788528-1788550 CCTGCCCCAGCCTGGGAGTGGGG - Intergenic
968907715 4:3462393-3462415 CCTCCACCACCCTGGGGTTGGGG - Intergenic
968907788 4:3462670-3462692 CCTGCTCTTGCCTGGGATGGGGG + Intergenic
969143799 4:5102563-5102585 CATACTCCAGCCTGGGAAAGAGG - Intronic
969634567 4:8359385-8359407 CTTGCTCAACCTTGGGTTAGAGG + Intergenic
971949900 4:33331826-33331848 CATGCTCCACCCTAGGATCAGGG - Intergenic
972582262 4:40405366-40405388 CCAGCTCCAGCCTGGGCTATAGG - Intergenic
975754014 4:77553656-77553678 CCTTCTCCTCCCTGGGATCTGGG + Intronic
976600704 4:86935252-86935274 CCTGCGCCACCCAGGGCTGGGGG + Intronic
976609122 4:87011138-87011160 CCTTCTCCACCCTGGGGCAGGGG + Intronic
982011229 4:151108036-151108058 TCTGCTACACCTTGGAATAGGGG + Intronic
982773496 4:159419731-159419753 TCTGCTCCATCCTTGGATATTGG + Intergenic
986307801 5:6528669-6528691 CATCCCCCACCCTGGGAAAGAGG + Intergenic
987695505 5:21324595-21324617 CCTGCTCCACCCAGGGAACGTGG - Intergenic
987934883 5:24451180-24451202 CCTGCTCCCCACTGGGCTAGAGG - Intergenic
991744900 5:69727504-69727526 CCTGCCCCACCCAGGGAACGTGG + Intergenic
991752805 5:69827722-69827744 CCTGCCCCACCCAGGGAACGTGG - Intergenic
991796470 5:70307232-70307254 CCTGCCCCACCCAGGGAACGTGG + Intergenic
991802423 5:70384456-70384478 CCTGCCCCACCCAGGGAACGTGG - Intergenic
991824280 5:70602818-70602840 CCTGCCCCACCCAGGGAACGTGG + Intergenic
991832124 5:70702850-70702872 CCTGCCCCACCCAGGGAACGTGG - Intergenic
991888848 5:71306788-71306810 CCTGCCCCACCCAGGGAACGTGG + Intergenic
992332914 5:75736221-75736243 CCTGCTGCAACCTGGGGAAGTGG - Intergenic
992872709 5:81022718-81022740 CGTCCTCCTCCCTGGGAGAGGGG + Intronic
993279639 5:85908527-85908549 CCTGCTCAGCCCTGGGAGTGGGG - Intergenic
993279751 5:85910082-85910104 CCTGCTCAGCCCTGGGAGTGGGG + Intergenic
997646369 5:135484767-135484789 CCTGCTCCAGACTGGGATGTGGG + Intergenic
997721138 5:136079284-136079306 CCTGCTACACCTAGGGCTAGTGG - Intergenic
997966402 5:138360024-138360046 CCTACCCCACCCTGAGACAGAGG - Intronic
998416837 5:141952301-141952323 CCTGCTCCAAGTTGGGTTAGGGG - Intronic
998463657 5:142326316-142326338 CCTGCTCCTCCCTGGAACGGAGG + Intronic
999004660 5:147962473-147962495 CCAGCTCCATCCAGGGCTAGGGG - Intergenic
1001080754 5:168665559-168665581 CCTGCTCCTCCCCAGGAGAGGGG - Intronic
1001266250 5:170276586-170276608 CCAGCTCCATCCTGGGATTTGGG - Intronic
1001707399 5:173751353-173751375 CCTGCTCCACCAGAGGATCGGGG - Intergenic
1005450291 6:25965508-25965530 CCTGCCTCACCCTGGCAGAGTGG - Intronic
1005555278 6:26973507-26973529 CCTGCCCCACCCAGGGAACGTGG + Intergenic
1006359623 6:33579960-33579982 CCTGCCCCACCCTGGGGCTGGGG + Intronic
1006400738 6:33815803-33815825 TCTGCTCCACCCTAGGTTGGAGG + Intergenic
1006850334 6:37093476-37093498 CCTGCTCCAGCCAGGGGTGGTGG - Intergenic
1006851539 6:37102399-37102421 GCTGCTCCTCCCTGGGGGAGGGG - Intergenic
1007430747 6:41775383-41775405 CCTGCTCCACCCTGGGATAGGGG - Intronic
1007573797 6:42911750-42911772 CCAGCTCCTCCCTGGGCTGGAGG + Intergenic
1007612434 6:43159116-43159138 CCTGCTGCACCCTTGGAAAAAGG - Intronic
1011786965 6:90857844-90857866 CCTGCTCCAGACTGGGAGAGGGG - Intergenic
1012142193 6:95637263-95637285 CCTGCTCAACCATGCGAGAGTGG + Intergenic
1013255508 6:108380585-108380607 CCTGCTCCAGAGTTGGATAGGGG - Intronic
1014188107 6:118458547-118458569 GCTCCTCCACCCTGGGGTAAAGG + Intergenic
1014568069 6:122975678-122975700 CCTGCTAGACTATGGGATAGTGG - Intergenic
1015480861 6:133707419-133707441 CCAGCTCCAGCATGGGATACAGG - Intergenic
1016026828 6:139296041-139296063 CCTCCTCCAGCCTGGGCTGGTGG + Intergenic
1016694168 6:146973575-146973597 CCTGCTCCCCTTTGGGCTAGTGG + Intergenic
1016814629 6:148292378-148292400 CCTGCTTTATCCTGGGATATGGG + Intronic
1019313198 7:372769-372791 TGTGCTCCACCCTTGGAGAGTGG + Intergenic
1019471518 7:1223933-1223955 CCTGCTCCCTCCCGGGATTGTGG + Intergenic
1019593905 7:1849669-1849691 CCTGCTCCCACCTGGGCTAAAGG + Exonic
1021656540 7:22879681-22879703 CCTGCTCCTCCCAGGTAAAGGGG - Intergenic
1022494567 7:30844739-30844761 CCTCAGCCACCCTGGGAGAGGGG + Intronic
1024691069 7:51804013-51804035 CCAGAGCCACCCGGGGATAGTGG - Intergenic
1025964680 7:66257321-66257343 CCTGTTCCACCCTTGTATACTGG - Intronic
1026169022 7:67936664-67936686 CCTGCTTCAGCCTGGGATACAGG - Intergenic
1028604863 7:92644664-92644686 CCTGGTCCACCCTGAAAAAGAGG + Intronic
1034303497 7:150034902-150034924 CCTCCCCCACCCTGCGATGGGGG + Intergenic
1034801540 7:154058934-154058956 CCTCCCCCACCCTGCGATGGGGG - Intronic
1034801622 7:154059177-154059199 CCTCCCCCACCCTGCGATGGGGG - Intronic
1035527956 8:328640-328662 CGTTCTCCAGCCTGGGACAGAGG - Intergenic
1035629124 8:1095007-1095029 CTTGCTCCACCTTGGGAAGGTGG - Intergenic
1037877296 8:22554372-22554394 TTGGCTCGACCCTGGGATAGGGG - Intronic
1041084077 8:54241294-54241316 CCTGCCCCAGCCTGGGATACAGG - Intergenic
1041340847 8:56843983-56844005 CCTGCCCCACCCAGGGCAAGAGG + Intergenic
1045005281 8:97912027-97912049 CATTCTCCACCCTGGGCAAGTGG - Intronic
1046323272 8:112606185-112606207 CCTGTGCCACCCTGGGGTACAGG - Intronic
1048317904 8:133375539-133375561 CCTTCTCCAGCCTGGAACAGTGG - Intergenic
1048855918 8:138686497-138686519 CCTGCTCCAGGCTTGGAGAGAGG - Intronic
1049182632 8:141230894-141230916 CCTGCCCCACCCGGGGATCCAGG + Intronic
1049337162 8:142092585-142092607 CCTGCTCCAACGTGGGTTGGGGG - Intergenic
1049463836 8:142742146-142742168 CCAGCTTCACCCTGGGACAGGGG - Intronic
1049756878 8:144314739-144314761 ACCGCACCACCCTGGGACAGAGG - Exonic
1051312978 9:15796630-15796652 CCTGCTCAACCCTGCGGTTGGGG + Intronic
1052044580 9:23779288-23779310 CCTGCTTCACACTGGCAAAGTGG + Intronic
1054856332 9:69903427-69903449 CCTGCTACACCCTGGAAAATGGG + Intronic
1060242142 9:121913076-121913098 CCTGCTCCACCCTAGACAAGGGG + Intronic
1060869416 9:127027956-127027978 CCTGCTAGACTCTGGGCTAGGGG - Intronic
1062212857 9:135373927-135373949 CCTGCTCCATCCGGAGACAGTGG + Intergenic
1062733328 9:138121086-138121108 CCTGGGTCACCCTGGGACAGTGG + Intronic
1186568432 X:10689303-10689325 CCTGCTCCAACATGTGATAAAGG - Intronic
1189323899 X:40101663-40101685 CCAGCTCCACCCTGGCCTAGGGG + Intronic
1189366138 X:40390217-40390239 CCTGCTCCACCATTGGATTGAGG - Intergenic
1190558928 X:51668297-51668319 CCTGCTCCAGCCTTGTATAGAGG + Intergenic
1190565363 X:51725025-51725047 CCTGCTCCAGCCTTGTATAGAGG - Intergenic
1190832324 X:54070274-54070296 CTTGTTTCACCCTGGGCTAGGGG + Exonic
1192220118 X:69192058-69192080 CCTGCTTCACCCTGGGGGAAAGG + Intergenic
1194247882 X:91537721-91537743 CCTGTACCTCCCTGGGACAGAGG + Intergenic
1200566899 Y:4779250-4779272 CCTGTACCTCCCTGGGACAGAGG + Intergenic
1201739047 Y:17304011-17304033 CCTGCTTCAGCCAGGGATACAGG + Intergenic