ID: 1007430749

View in Genome Browser
Species Human (GRCh38)
Location 6:41775384-41775406
Sequence CCCTGCTCCACCCTGGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430749_1007430760 12 Left 1007430749 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 330
Right 1007430760 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 113
1007430749_1007430755 -6 Left 1007430749 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 330
Right 1007430755 6:41775401-41775423 GCAGGGCCTGGTACTCACCCTGG 0: 1
1: 0
2: 7
3: 38
4: 301
1007430749_1007430757 9 Left 1007430749 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 330
Right 1007430757 6:41775416-41775438 CACCCTGGCCTGTCTGACATCGG 0: 1
1: 0
2: 0
3: 14
4: 203
1007430749_1007430762 25 Left 1007430749 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 330
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430749 Original CRISPR CCCTGCTCCACCCTGGGATA GGG (reversed) Intronic
900536925 1:3183284-3183306 CCCTTCTCCACCCTGAGCTCCGG - Intronic
900623630 1:3598506-3598528 CACTGCTGCAGCCTGGGAGAGGG - Intronic
901019859 1:6250061-6250083 CCCTTCTCCACCCTGGGGAAAGG + Intronic
902360592 1:15940829-15940851 GCCTGCTTCACACTGGGAGAAGG - Intergenic
903255869 1:22099125-22099147 CCCTGCTTCACCACGGCATAGGG + Intergenic
904498842 1:30902571-30902593 CCCTGCTCCCTGCTGGGACAGGG + Intronic
905227595 1:36489417-36489439 TCCTGCTCCTCCCTGGGCAATGG - Intergenic
905627790 1:39499670-39499692 TCCTCCTCCAGCCTCGGATAAGG - Intronic
905646709 1:39629854-39629876 CCAGGCTCCTCCCTGGGTTAAGG + Intronic
905967864 1:42114423-42114445 CCCTGCCCCACCCTGGAGCAGGG + Intergenic
906196521 1:43933695-43933717 CCCAGCCCCACCCCGGGATCTGG + Exonic
907552821 1:55318764-55318786 CCCAGCTCCACCCTGGGTTCAGG + Intergenic
911599856 1:99836255-99836277 TCCTGCTCCTCCCTGGGCAATGG - Intergenic
915126049 1:153665820-153665842 CCTTGCTTCAGCCTTGGATATGG - Intronic
915479913 1:156177455-156177477 CCCTGCATGACCCTGGGAGAAGG - Exonic
916810444 1:168301016-168301038 CCCTCCACCATCCTGGGACATGG - Intronic
918711925 1:187741769-187741791 CCATGCTCCAGCCTGGGTGATGG + Intergenic
919411214 1:197245742-197245764 CGCTGCTCCAGCATGGGAAAGGG + Intergenic
920198095 1:204242957-204242979 CCCAGCTGGACTCTGGGATAAGG - Intronic
922248288 1:223821926-223821948 CTGTGCTCCAGCCTGGGAGATGG - Intronic
922315250 1:224435401-224435423 CTCTGCTCCACCCTGGGAAGGGG + Intronic
922321339 1:224490431-224490453 CTCTGCTCCCCCATGGGATGTGG + Intronic
922440767 1:225653381-225653403 CCCTGCACCCCTCTGGGATTCGG + Intergenic
923095032 1:230768388-230768410 TCCAGCTCCACCCTGGGACTGGG + Intronic
924232004 1:241970226-241970248 CACTGCACCAGCCTGGGCTATGG - Intergenic
1065396235 10:25241455-25241477 CTGTGCTCCAGCCTGGGAGATGG - Intronic
1065571281 10:27072977-27072999 CCCAGCACCACCCTGGAGTATGG + Intronic
1066071360 10:31817170-31817192 CACTGCTCCAGCCTGGGTGATGG + Intronic
1069920003 10:71810691-71810713 CCCTGCCCCAGTCTGGGAGATGG - Intronic
1070665032 10:78336713-78336735 CCCTGCTCCAGCCTGGGAGGTGG - Intergenic
1070768970 10:79071243-79071265 CCCTGCTGCAACCTGGGAACCGG + Intronic
1071152846 10:82655544-82655566 CCCTCCTCTACTCTGGGAAAGGG + Intronic
1071482198 10:86073346-86073368 CCCTGTTACACACTGGGGTAGGG + Intronic
1072432150 10:95382413-95382435 CCCTGTTCCACACTGGAATAGGG + Intronic
1074121790 10:110498570-110498592 CCCTCCTACACCCTGGGACCGGG + Intronic
1074780162 10:116796747-116796769 CCCAGCCCCACCCTTGGATGGGG + Intergenic
1074870975 10:117575862-117575884 CCCTGCCCCACCCTGGGAGGTGG + Intergenic
1075234058 10:120710712-120710734 CCCTGGGCCACTGTGGGATAAGG + Intergenic
1076204690 10:128587756-128587778 CCCTGTTCCACACTGGGGTTAGG + Intergenic
1076834435 10:133014017-133014039 CCCTGGTCGACCCTGGAACATGG - Intergenic
1076865352 10:133163890-133163912 CCCTCCTCCCACCTGGGATGGGG + Intronic
1076865371 10:133163944-133163966 CCCTCCTCCCACCTGGGATGGGG + Intronic
1076865407 10:133164052-133164074 CCCTCCTCCCACCTGGGATGGGG + Intronic
1077193733 11:1268404-1268426 CCCTTCTCTGCCCTGGGATCAGG + Intergenic
1077298698 11:1837651-1837673 CCCTGCTTGACCCTCGGGTAGGG + Intergenic
1077390620 11:2299178-2299200 CCCTCCTCCTCCCTGGGCTCAGG + Intronic
1077894452 11:6443284-6443306 TCCTGCTCCACCCAGGGACTAGG + Intergenic
1080763664 11:35276375-35276397 CCCAGCTCCAGCCTAGGATGGGG + Intronic
1081487980 11:43546766-43546788 CCCTCCTCCAGCCTGGGGTTGGG - Intergenic
1082820796 11:57543484-57543506 CCCTCCCCCACCCTGGGCTCTGG - Intronic
1083235990 11:61350953-61350975 CCCTGTCCCACCCTGGAATGTGG + Intronic
1083852115 11:65374306-65374328 CCCTGCTCCACCTGGGCACATGG - Intergenic
1083852122 11:65374332-65374354 CCCTGCTCCACCTGGGCACATGG - Intergenic
1083852730 11:65377487-65377509 ACCTCCTTCACCCTGGGAAAGGG - Intronic
1084441899 11:69179327-69179349 CCAAGCTCCAGCCTGGGACAAGG + Intergenic
1084736193 11:71107204-71107226 CCCTGCGTCACCCAGGGAGATGG - Intronic
1084972152 11:72777845-72777867 CCCACCCCCACCCTGGGATCAGG + Intronic
1085410190 11:76286227-76286249 CCCTGCCCCTCCCTGGGCTCTGG - Intergenic
1085534681 11:77210989-77211011 CACTGCTCCCCCAGGGGATACGG - Intronic
1089322435 11:117635512-117635534 CCCTGCTGCACCCTGGGAAATGG - Intronic
1090975745 11:131678526-131678548 CACAGCTCCACACTGGGAGAGGG - Intronic
1091829936 12:3542390-3542412 CCCTGCTCTCCACTGGGCTAGGG + Intronic
1094160734 12:27387400-27387422 ACCTTCTCCCCACTGGGATATGG + Intronic
1094540803 12:31361992-31362014 CTCTGCCCAACCCTGGGAAACGG + Intergenic
1094739034 12:33267666-33267688 GTCTGCACAACCCTGGGATATGG + Intergenic
1095050131 12:37547376-37547398 CACTGCTCCACCCAGGAAGAAGG + Intergenic
1096522323 12:52191406-52191428 CCCTGATCCATCCTGGCATGTGG - Intronic
1096771634 12:53939249-53939271 TCCAGCGCCACCCTGGGCTACGG + Exonic
1098149980 12:67536997-67537019 CTCTGCTTCACCCTGGGTTCAGG + Intergenic
1098450985 12:70617830-70617852 CCTTGCTCCGGCCTGGGAGAAGG - Intronic
1099654304 12:85469385-85469407 TCCTGCTCCTCCCTGGGCAATGG - Intergenic
1100449690 12:94694059-94694081 CCCAGCCCCACCCTGGCATAAGG + Intergenic
1101052377 12:100876342-100876364 CCCCACTCCACCCTTGGACATGG - Intronic
1102565300 12:113793608-113793630 CCCTGCTCCACCCAGCTACAGGG + Intergenic
1103227720 12:119302631-119302653 GCCTGCTCTGCCCTGGGAAATGG - Intergenic
1103324657 12:120112340-120112362 TCCTGCTCCTGCCTGGGCTATGG + Intronic
1104008923 12:124915155-124915177 CCCTGGCCCACCCTGCGAGATGG + Exonic
1104713571 12:131002782-131002804 CCCAGGTCCACTCTGGGATGGGG - Intronic
1105518185 13:21109279-21109301 CCCAGCTCCACCATGGGCTCTGG + Intergenic
1105920296 13:24956997-24957019 TCCTGCTCCTCCCTGGGCAATGG - Intergenic
1106101385 13:26697111-26697133 CCCAGCTCCACCCTGGGTCTAGG + Intergenic
1106630600 13:31467915-31467937 CCCTGCCCCAGCCTGGCAGAAGG - Intergenic
1106900837 13:34353462-34353484 GCATGCTCTAACCTGGGATAAGG + Intergenic
1112436106 13:99392369-99392391 CCCTGCTGCGGCCTGGGAGAGGG + Intergenic
1113626804 13:111853810-111853832 CCCCGCTCCTCCCTGGGGTGTGG + Intergenic
1113912769 13:113852049-113852071 CCCTGCTTCACCCAGGGACGGGG - Intronic
1114063319 14:19038735-19038757 CCCGGCTCCGCCCTGGACTAAGG - Intergenic
1114098937 14:19361261-19361283 CCCGGCTCCGCCCTGGACTAAGG + Intergenic
1114321902 14:21553941-21553963 CCCTGCTTCTCCCTGGGAGGAGG + Intergenic
1115754187 14:36517291-36517313 TCCTGCTCCACCTTGCTATACGG - Exonic
1117100245 14:52338559-52338581 CCATCCTCCACCCTGGTGTAGGG + Intergenic
1117300800 14:54425011-54425033 CCCTCCTCTACCCTGGAATGAGG + Exonic
1118404921 14:65413198-65413220 CTCTGCTCCCGCCTGGGGTAAGG + Intronic
1118870077 14:69734126-69734148 CCCCACTCTACCCTGGGATGAGG + Intronic
1119382348 14:74237315-74237337 GCCAGCTCCACCCTGGGAGCTGG - Intergenic
1119735083 14:76976507-76976529 CCCTGCCCCTCCCTGGGAGAGGG - Intergenic
1120423319 14:84315764-84315786 CCCTGCGCCACCCTAGCAGAGGG + Intergenic
1121528910 14:94638978-94639000 CCCTGGTCCAACCTGGGCTCTGG - Intergenic
1121717489 14:96086746-96086768 CCCTGCACCACCATGGGGTGAGG + Exonic
1121788011 14:96677399-96677421 CCCTGATCCAGCCTGGGATCAGG - Intergenic
1122178504 14:99938050-99938072 TCCTGCCGCACCCTGGGGTAGGG + Intronic
1122205678 14:100146789-100146811 ACCCGCTTCACCCTGGCATAGGG + Exonic
1122918658 14:104870617-104870639 GCCTGCTTCTCCCTGGGGTAGGG + Intronic
1122973955 14:105163511-105163533 CCCTGCTCAGGCCTGGGATGTGG + Intronic
1123055677 14:105568553-105568575 CCCGGCTCCCCCCTGGGCTGGGG - Intergenic
1123080036 14:105688072-105688094 CCCGGCTCCCCCCTGGGCTGGGG - Intergenic
1123493688 15:20801249-20801271 CCCTGCCTCACCCTGGTCTAAGG + Intergenic
1123550186 15:21370314-21370336 CCCTGCCTCACCCTGGTCTAAGG + Intergenic
1123696229 15:22880893-22880915 CCCTGTACCACACTGGGAAATGG + Intronic
1124700108 15:31905256-31905278 GCCTTCTCCACACTGGGAGAAGG - Intergenic
1125328266 15:38558981-38559003 CTCTGCTTCACCGTGGGAGATGG + Intronic
1125605549 15:40937943-40937965 CCCTGGGCCTCCCTGGGAGAAGG - Intronic
1127142330 15:55990719-55990741 CCATGCACCTCCCTGTGATATGG - Intronic
1129678255 15:77643818-77643840 TCCTGCTCCAGCATGGGAAAGGG + Intronic
1131143876 15:89999800-89999822 ATCTGCTCCTCCCTGGGAGAAGG + Intergenic
1202958527 15_KI270727v1_random:97569-97591 CCCTGCCTCACCCTGGTCTAAGG + Intergenic
1132465489 16:75588-75610 CCTTGCCAAACCCTGGGATATGG - Intronic
1132587074 16:710242-710264 CCCAGCTCCACCCAGGGAGGGGG + Intronic
1132684803 16:1157856-1157878 CCCTGGTCCACCCAGGCAGAAGG - Intronic
1134627138 16:15730241-15730263 CACTGCACCACCCTGAGATTGGG - Intronic
1135744760 16:25007400-25007422 CCGTGCTCCAGCCTGGGTGATGG - Intronic
1136064897 16:27751975-27751997 CCCTGCTCTACTCTGAGTTAGGG - Intronic
1136254512 16:29029308-29029330 CCCTGCAACACCTTGGGATCAGG + Intergenic
1136540513 16:30925462-30925484 CCCTCCTGCTCCCTGGGCTAGGG + Intronic
1138567801 16:57846203-57846225 CCCAGCCCCACCCAGGGAGAGGG - Intronic
1139215038 16:65119647-65119669 CCCTCCTCACCCCTGGGAAAGGG - Intronic
1140667287 16:77239172-77239194 CCGTACTCCACCCTGGGTGATGG + Intergenic
1141158131 16:81610945-81610967 CCCTGCTCCAGGGTGGGAGAGGG + Intronic
1141905095 16:87019489-87019511 CTCAGTTCCACCCTGGGAAAAGG + Intergenic
1142018544 16:87765709-87765731 CCCTGCGCCCCCCGGGGTTACGG - Intronic
1142742243 17:1937922-1937944 CCTTGCTCCAGCCAGGGACAAGG - Intronic
1142846902 17:2685798-2685820 CCCTCCTCCACCCGGGGGAAGGG - Intergenic
1143149931 17:4801511-4801533 CCCTCCTCAACCCTGGGTTGGGG - Intergenic
1143622924 17:8091304-8091326 CCCAGGGCCACCCTGGGATTTGG - Intergenic
1144019925 17:11231734-11231756 TCCAGCTGCTCCCTGGGATATGG - Intergenic
1144182929 17:12769837-12769859 CCCTGCTCGGCCCTGAGCTATGG + Intergenic
1144668289 17:17116812-17116834 CCCTGCTCTCCCCTGGAATGTGG + Intronic
1146212027 17:30950306-30950328 CCCTGGCCCAGCCTGAGATAGGG - Intronic
1147594280 17:41706523-41706545 CCATGATCCCCCCTGGGGTAGGG - Intergenic
1147683274 17:42269108-42269130 CTGTGCTCCAGCCTGGGAGACGG - Intronic
1147866153 17:43553840-43553862 CTCTTCTCCACCCAGGCATATGG - Intronic
1151290601 17:73147175-73147197 TCCTGCTCCAGCCTGGGAGTGGG - Intergenic
1151545724 17:74791723-74791745 ACCTGCTCCTTCCTGGGATCTGG + Intronic
1152286356 17:79415386-79415408 CCCTCCCCCACCCAGGGAGAAGG + Intronic
1152511761 17:80794800-80794822 CCATGCGCCACCCTTGGAGATGG - Intronic
1153769938 18:8407404-8407426 CTCTGCGCCACCCTGGGCTCTGG + Intergenic
1154451216 18:14475712-14475734 CCCTGCCTCACCCTGGACTAAGG + Intergenic
1156460697 18:37319852-37319874 CCCTGCCACACCCTGGGCTCTGG - Intronic
1162538718 19:11280180-11280202 TCCTGCTGCACCCTGGGCAATGG + Intergenic
1162823619 19:13237792-13237814 CCCAGCTCCACCTGGGGATGGGG + Intronic
1162907428 19:13831982-13832004 CCCTTCTCCTCCCTGGGTCAAGG - Exonic
1163392657 19:17039684-17039706 CCCTGCCCTACCCTGGGACTTGG + Intergenic
1163517627 19:17774580-17774602 TCCTGGTCCAGCCTGGAATATGG - Intronic
1163831270 19:19548213-19548235 CCCTGCCCCACCCTAGGGAAGGG - Intergenic
1163898836 19:20082833-20082855 TCCTGCTCCTCCCTGGGCAATGG + Intronic
1165410630 19:35658681-35658703 CCCTTCACCATCCTGGGAGAAGG - Exonic
1165430002 19:35767122-35767144 CACTGCTCCACAGTGGGACATGG - Intronic
1167462294 19:49632041-49632063 CCATGCTCCACCCTAGGACTAGG + Intergenic
1167485748 19:49762030-49762052 CCCTACCCTACCCTGGGATCCGG - Exonic
1167617936 19:50546497-50546519 CCCTGCCCCACCCAGAGACATGG - Intronic
1167885264 19:52494752-52494774 TCCTACCCCACCCTGGGAAAAGG - Intronic
1167903029 19:52636388-52636410 CCCTACCCCACTCTGGGAAAAGG + Exonic
1167909154 19:52687900-52687922 TCCTACCCCACCCTGGGAAAAGG + Intronic
1167921169 19:52784487-52784509 TCCTACCCCACCCTGGGAAAAGG + Intronic
1167927668 19:52834687-52834709 CCCTGCTTGAACCTGGGAGAAGG + Intronic
1168116260 19:54222697-54222719 CCCTACTCCTCACTGGGACAGGG - Intronic
1168181095 19:54663595-54663617 CCCTCCTCCTCACTGGGACAAGG + Intronic
925203982 2:1991209-1991231 CCCGGATCCACCCTGTGATTTGG - Intronic
925769315 2:7267012-7267034 CCCTGCTCCACGCTGTGAGCTGG + Intergenic
925929925 2:8698743-8698765 CTGTGCTAGACCCTGGGATACGG - Intergenic
926177848 2:10612537-10612559 CTGTACTCCAGCCTGGGATACGG - Intronic
927114228 2:19885815-19885837 CTCTGCCCCACCCTGGGACACGG + Intergenic
929453924 2:42053447-42053469 TCCTCCTCCACCCAGGGAGAGGG + Intronic
929560649 2:42954391-42954413 ACCTGCCCCACCCTGGGAGCTGG + Intergenic
930587339 2:53283122-53283144 GCCTGCTTCACCCTGGTTTAGGG - Intergenic
931575980 2:63719293-63719315 CCCTGCACCACCCAGGGTTCTGG - Intronic
932163163 2:69481487-69481509 CCCAGCTACATCCTGGGATGGGG - Intronic
934529271 2:95075070-95075092 CCCTGCCCAACCCTGGGAGCAGG + Intergenic
934940699 2:98499923-98499945 CCCTGCTGGACCCTGGGCTCAGG - Intronic
935653652 2:105403552-105403574 TCCTGCTGCACTCTGGGACAAGG - Intronic
937070849 2:119061946-119061968 GACTGCTCCACCCTGGGGTGGGG + Intergenic
937612589 2:123879635-123879657 CCCTGCTCCACTCTGGGCTGTGG - Intergenic
938480663 2:131658901-131658923 CCCGGCTCCACCCTGGACTAAGG - Intergenic
943977662 2:194504759-194504781 TCCTGCTCCTCCCTGGGCAATGG - Intergenic
947523475 2:230865246-230865268 CCCTGCTCCACCCCGGGCTCTGG - Intronic
948855342 2:240727703-240727725 CCCTGAGCCACCCTGGGACAGGG - Intronic
949023753 2:241755376-241755398 CCCTGCCCCACCCTGGTTCAGGG + Intronic
1169415841 20:5415530-5415552 ACCTGCTCCACCACGGGATCAGG + Intergenic
1170626543 20:18034360-18034382 TCCTGATCCCCCCTGGGATGAGG + Intronic
1170768955 20:19315537-19315559 CCCTGAACCTCCCTGGGCTATGG + Intronic
1171249355 20:23636712-23636734 ACCTGCTAGACCCTGGGAAATGG + Intronic
1172701186 20:36854598-36854620 GGCTGCTCCACCATGGGGTAGGG + Intronic
1174533346 20:51232000-51232022 CCCTGCCCAGCCCTGGGAAATGG + Intergenic
1175870725 20:62208301-62208323 CTCTGCTCCACCCTTGGCTGGGG - Intergenic
1176444925 21:6814523-6814545 CCCTGCCTCACCCTGGACTAAGG - Intergenic
1176705926 21:10119977-10119999 CCCTGCTCCACCCAGGAAGGAGG - Intergenic
1176823090 21:13679556-13679578 CCCTGCCTCACCCTGGACTAAGG - Intergenic
1179783643 21:43718263-43718285 CCCTGCACCACCCCGGGGAACGG - Intergenic
1180481815 22:15761369-15761391 CCCGGCTCCGCCCTGGACTAAGG - Intergenic
1180972644 22:19823336-19823358 CCCTGCTCCAGCCTGTGATGGGG + Intronic
1181006180 22:20014767-20014789 CCCTGCTCCACCCAGAGACCGGG + Intronic
1181455692 22:23059039-23059061 CCCTTCCCCACCCTGGGTGATGG - Intergenic
1181627563 22:24132023-24132045 CTATACTCCACCCTGGGTTACGG + Intronic
1181674239 22:24441458-24441480 TCCTGCTCCATCCTGGGCCAGGG - Exonic
1181922760 22:26333473-26333495 CCCTGCTCCAACCTTGGGAAGGG - Intronic
1183279002 22:36922325-36922347 CACTGCTGCACCCTGGGGGAGGG + Intronic
1183414110 22:37672974-37672996 TCCTCCTCCACCCTGGAAAATGG - Intergenic
1183888993 22:40909734-40909756 CAGTGCTCCAGCCTGGGCTATGG + Intronic
1184450947 22:44582413-44582435 CCCTGCCCCACTCTGGGAGCAGG - Intergenic
949894532 3:8759570-8759592 CCCTGCTCAACCACAGGATATGG + Intronic
950253018 3:11482538-11482560 CCCTGCTCCACCTGGGTCTAGGG + Intronic
950541665 3:13616806-13616828 CCCAGCACAACCCTGGGAGATGG + Intronic
952857811 3:37786554-37786576 CTCTGCTCCAGCCTGGGCAACGG + Intronic
952923773 3:38307059-38307081 ACCTGCTCCACCCTGAGAGCTGG - Intronic
953374013 3:42413511-42413533 CCCTGCTGCACCCTGGCAGGTGG - Intergenic
953404501 3:42653935-42653957 CCCTGCGCCGCCCTGGGATAGGG + Intronic
953582237 3:44167589-44167611 CCCAGCTCCACCCTTGGGAAGGG + Intergenic
954373546 3:50182839-50182861 CCCTGCTCCAGCCAGGGCTTGGG + Intronic
954580185 3:51699038-51699060 CCCTGGACCACCCCAGGATAGGG - Intronic
954876353 3:53805508-53805530 CCCTGCTGCACTCTGTGATGGGG + Intronic
955203387 3:56873384-56873406 CCCCGCTCCACTCTCTGATAGGG + Intronic
956001176 3:64731520-64731542 TACTGCTCCACCCTTGGATCTGG - Intergenic
957165964 3:76674403-76674425 CCCTGCTTGATCCTGGGATGGGG - Intronic
959818964 3:110709629-110709651 CCCTGCCTCACCTTGAGATAAGG + Intergenic
961963783 3:130881077-130881099 TCCTGCTGCACACTGGGATGTGG - Intronic
962040124 3:131698196-131698218 CTGTGCTCCAGCCTGGGAGAGGG + Intronic
962754424 3:138457212-138457234 CCCAGCTCCACCCTGTGCTGTGG + Intronic
966519304 3:180855503-180855525 CCCTGCTCAACCCTGAGGTGGGG - Intronic
968076356 3:195817767-195817789 CCCTGCTGAACCATGGAATAAGG - Intergenic
969281789 4:6175655-6175677 CCCAGCTCCACCCAGGCAGATGG + Intronic
969721597 4:8895390-8895412 CCCTGCCCCACACTGGGAGGGGG - Intergenic
970404307 4:15747704-15747726 CTGTGCTCCAGCCTGGGAGAAGG - Intergenic
970579396 4:17461031-17461053 CCGTACTCCAGCCTGGGAAACGG - Intronic
971949901 4:33331827-33331849 ACATGCTCCACCCTAGGATCAGG - Intergenic
973711049 4:53630935-53630957 CCCTGATCCACCCTGGTGGATGG - Intronic
975442160 4:74423231-74423253 CCCTACTACAGCCTGGGATGTGG - Intergenic
975754012 4:77553655-77553677 CCCTTCTCCTCCCTGGGATCTGG + Intronic
976405974 4:84660595-84660617 TTCTGCTCCATCCTGGGCTAGGG - Intergenic
976600702 4:86935251-86935273 CCCTGCGCCACCCAGGGCTGGGG + Intronic
976609120 4:87011137-87011159 CCCTTCTCCACCCTGGGGCAGGG + Intronic
977634312 4:99279425-99279447 ACCTGCTTCACTCTGGGAAAAGG - Exonic
977636992 4:99310764-99310786 ACCTGCTTCACTCTGGGAAAAGG - Exonic
978928160 4:114275732-114275754 TCCTTCTCCAAGCTGGGATAAGG + Intergenic
978942022 4:114448135-114448157 CCTAGCTCCACCCTAGAATAAGG + Intergenic
978942043 4:114448261-114448283 CCTAGCTCCACCCTAGAATAAGG + Intergenic
978942064 4:114448387-114448409 CCTAGCTCCACCCTAGAATAAGG + Intergenic
980173828 4:129321278-129321300 CTCTGCTTCACCCTGGCACAAGG + Intergenic
980354458 4:131724565-131724587 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980354992 4:131727071-131727093 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980356080 4:131732049-131732071 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980356615 4:131734537-131734559 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980357151 4:131737025-131737047 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980357693 4:131739520-131739542 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980358231 4:131742006-131742028 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980358763 4:131744500-131744522 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980359303 4:131746973-131746995 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980360386 4:131751936-131751958 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980361469 4:131756891-131756913 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980362552 4:131761846-131761868 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980363096 4:131764325-131764347 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
980378187 4:131976663-131976685 CCCTGCTCCACCCAGGAAGGTGG - Intergenic
981606580 4:146546672-146546694 CTCTGCACCTCCCTGGGACAGGG - Intergenic
981739191 4:147984871-147984893 CCCTGCTCCAACCTGGAGGAGGG + Intronic
984012142 4:174383528-174383550 TCCTGCTCCTCCCTGGGCAATGG + Intergenic
985772061 5:1817878-1817900 CAAAGCTCCACCCTGGGCTACGG + Intergenic
985909778 5:2869776-2869798 CCACGCTCCACCCTGGGGGAAGG + Intergenic
986605018 5:9514123-9514145 CCCTGCTCCTCCCTTGTAGATGG - Intronic
987101943 5:14598679-14598701 CCATGCTCCAGCCTGGGCAACGG + Intronic
990197382 5:53334011-53334033 TCCTACTCCAGCTTGGGATAGGG - Intergenic
990397185 5:55394447-55394469 CCCTGCTCCACACTGGTCCATGG - Intronic
990475401 5:56157492-56157514 TCCTGCTCCTCCCTGGGCAATGG + Intronic
991533025 5:67636608-67636630 CCATGCTCCCACCTGGGTTAAGG - Intergenic
992162121 5:74013916-74013938 CACTTCTCCTCCCTGGGTTATGG + Intergenic
992872708 5:81022717-81022739 CCGTCCTCCTCCCTGGGAGAGGG + Intronic
993279641 5:85908528-85908550 CCCTGCTCAGCCCTGGGAGTGGG - Intergenic
993279749 5:85910081-85910103 CCCTGCTCAGCCCTGGGAGTGGG + Intergenic
993913947 5:93718398-93718420 CACTGCTCCAGCCTGGGCAATGG + Intronic
994979478 5:106855128-106855150 CCCAGCTCCTCCCTTGCATAAGG - Intergenic
996838274 5:127818623-127818645 TCCAGCTCCACCCTGGGTTAGGG - Intergenic
997646367 5:135484766-135484788 GCCTGCTCCAGACTGGGATGTGG + Intergenic
998416839 5:141952302-141952324 CCCTGCTCCAAGTTGGGTTAGGG - Intronic
999004662 5:147962474-147962496 CCCAGCTCCATCCAGGGCTAGGG - Intergenic
1001266252 5:170276587-170276609 CCCAGCTCCATCCTGGGATTTGG - Intronic
1001416100 5:171545651-171545673 CCCTGCTCCTCAATGGGAAATGG - Intergenic
1001512124 5:172331291-172331313 GCATGCTCCACCCTGAGAAATGG - Intronic
1002322121 5:178382464-178382486 CCCTGCCCCAGCCTGGCATTAGG - Intronic
1002950051 6:1800779-1800801 GCCTGCTTCACCCAGGGCTAAGG - Intronic
1004638327 6:17489759-17489781 CCCAGCTCCAGACTGGGATCTGG - Intronic
1005021499 6:21423443-21423465 ACCTGCTCCAATCTGGGAGAGGG - Intergenic
1005534873 6:26745168-26745190 TCCTGCTCCTCCCTGGGCAATGG + Intergenic
1005841346 6:29746281-29746303 CATTGCTTCTCCCTGGGATACGG - Intergenic
1006359621 6:33579959-33579981 CCCTGCCCCACCCTGGGGCTGGG + Intronic
1007430749 6:41775384-41775406 CCCTGCTCCACCCTGGGATAGGG - Intronic
1009223195 6:61001951-61001973 CCCTACACAACCCTGTGATATGG + Intergenic
1009941410 6:70293129-70293151 CCCTGCTACACTCCGTGATATGG + Intronic
1010465767 6:76165759-76165781 CCCTGCACTTCCCTGGGATGGGG + Intergenic
1011348767 6:86399978-86400000 CCCTGCACAACCTTGGGACATGG - Intergenic
1011786967 6:90857845-90857867 ACCTGCTCCAGACTGGGAGAGGG - Intergenic
1013268994 6:108528405-108528427 CCCTGGACCACCCTTGGACAAGG + Intergenic
1015744517 6:136496131-136496153 CTTTGCCCCACCCTGGGGTAGGG - Intronic
1016814627 6:148292377-148292399 ACCTGCTTTATCCTGGGATATGG + Intronic
1022494565 7:30844738-30844760 CCCTCAGCCACCCTGGGAGAGGG + Intronic
1023984435 7:45086699-45086721 CCCTCCTGCACCCAGGGAGATGG + Intronic
1024723065 7:52159960-52159982 CCCTCCTCCACCCAGGGCCAAGG + Intergenic
1029514264 7:101016121-101016143 CCCTTGTCCTCACTGGGATAAGG - Intronic
1034169800 7:149054210-149054232 CCCTTCACCACCCTGGGAGAAGG - Intergenic
1035113943 7:156507037-156507059 CCCTGCTTGACTCTGGGGTAGGG + Intergenic
1037877297 8:22554373-22554395 CTTGGCTCGACCCTGGGATAGGG - Intronic
1039517388 8:38145304-38145326 CCGTGCTCCGCCCTGGCAAATGG + Exonic
1045013861 8:97981827-97981849 GCCTGCACCACCCTGGGCTGGGG - Intronic
1045372169 8:101535380-101535402 CCTGGCTTCACCCTGGGATCTGG - Intronic
1047512114 8:125523313-125523335 CTGTGCTCCAGCCTGGGAGATGG + Intergenic
1047747717 8:127857187-127857209 CTGTACTCCACCCTGGGATACGG + Intergenic
1048728849 8:137414795-137414817 TCCTGCTCCTCCCTGGGCAATGG - Intergenic
1049212483 8:141393025-141393047 CACTGCTCCAACCTGGGAGCAGG - Intronic
1049329549 8:142042962-142042984 CCCTGCTGGACCCGGGGAGAGGG + Intergenic
1049337164 8:142092586-142092608 CCCTGCTCCAACGTGGGTTGGGG - Intergenic
1049463838 8:142742147-142742169 CCCAGCTTCACCCTGGGACAGGG - Intronic
1049615535 8:143574276-143574298 CCCAGCACCACCCTGGCATCTGG - Intergenic
1049788199 8:144461410-144461432 CCCTGCTGCTACCTGGGAAAGGG + Intronic
1051310191 9:15762793-15762815 CCCTGCTCCTACCTGGTCTAAGG + Intronic
1051312976 9:15796629-15796651 CCCTGCTCAACCCTGCGGTTGGG + Intronic
1052212756 9:25926490-25926512 CCGTGCTCCAGCCTGGGTGATGG + Intergenic
1052816130 9:33103647-33103669 CCCCGCCCCACCCTGGGCTGAGG - Intergenic
1053424852 9:38004047-38004069 CCCTGCTCCTGCCTGGGCTTTGG + Intronic
1053643206 9:40107095-40107117 CCCTGCTCCACCCAGGAAGGAGG - Intergenic
1053762944 9:41358395-41358417 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
1054324059 9:63704323-63704345 CCCTGCTCCACCCAGGAAGGAGG - Intergenic
1054541549 9:66269508-66269530 CCCTGCTCCACCCAGGAAGGAGG + Intergenic
1054856330 9:69903426-69903448 CCCTGCTACACCCTGGAAAATGG + Intronic
1055265141 9:74486644-74486666 CCATGGTCTACCCTGGGAAAAGG - Intergenic
1055454548 9:76460113-76460135 CCCTCATCCACGCTGGGAGACGG - Intronic
1056225482 9:84490843-84490865 ACCTGCTTCACCCTGGATTATGG + Intergenic
1056287728 9:85108192-85108214 CCCTTCTCCCACCTGGGAGAAGG - Intergenic
1057195518 9:93114049-93114071 CCCTCCTCCACCCTGAGCCATGG + Intergenic
1057220370 9:93254461-93254483 CCCTGCTGCACCCTTGCATGCGG + Intronic
1057618217 9:96612525-96612547 CTGTGCTCAACCCTGGGATGGGG + Intronic
1057950477 9:99365700-99365722 CCCTGCTCCACCCTCAGAAGAGG + Intergenic
1060014969 9:120079102-120079124 CCCTGCTCCACCCCAAGACATGG - Intergenic
1060242140 9:121913075-121913097 CCCTGCTCCACCCTAGACAAGGG + Intronic
1060891248 9:127189860-127189882 CCCTTCTCCACCCTGTGCCACGG - Intronic
1061033826 9:128102549-128102571 CCCAGCTGCACTCTGGGATGGGG - Intronic
1061510394 9:131057452-131057474 CCCTGGTCCTTCCTGGGAAAAGG - Intronic
1062282869 9:135759755-135759777 ACCTTCTCCACCGTGGGCTACGG + Exonic
1062720884 9:138043389-138043411 CCCTGCTCCTCCCTGTGCTGCGG + Intronic
1202790960 9_KI270719v1_random:90065-90087 CCCTGCTCCACCCAGGAAGGAGG - Intergenic
1203524272 Un_GL000213v1:70002-70024 CCCTGCCTCACCCTGGACTAAGG + Intergenic
1186043854 X:5511980-5512002 AACTGCTCCTCCCTGAGATAAGG + Intergenic
1186262272 X:7791981-7792003 CCCTGCTCCTCCCTGGAGTGAGG - Intergenic
1186806316 X:13143515-13143537 CCCTGTCCCACCCTGGGTGAAGG - Intergenic
1189323897 X:40101662-40101684 TCCAGCTCCACCCTGGCCTAGGG + Intronic
1189686212 X:43565895-43565917 CCCTGCCCCAACTTGGGAGAAGG + Intergenic
1191838237 X:65488382-65488404 CCCTACCCCACCCTGCGACATGG - Intronic
1197194034 X:123680161-123680183 TCCTGCTCCTCCCTGGGCAATGG + Intronic
1198309979 X:135421643-135421665 TGCCGCTCCACCCTGGGAAATGG + Intergenic
1198803324 X:140469534-140469556 CCCTTTTCCACCCTGGGTTTTGG - Intergenic