ID: 1007430751

View in Genome Browser
Species Human (GRCh38)
Location 6:41775385-41775407
Sequence GCCCTGCTCCACCCTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430751_1007430762 24 Left 1007430751 6:41775385-41775407 CCTATCCCAGGGTGGAGCAGGGC 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430751_1007430755 -7 Left 1007430751 6:41775385-41775407 CCTATCCCAGGGTGGAGCAGGGC 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1007430755 6:41775401-41775423 GCAGGGCCTGGTACTCACCCTGG 0: 1
1: 0
2: 7
3: 38
4: 301
1007430751_1007430757 8 Left 1007430751 6:41775385-41775407 CCTATCCCAGGGTGGAGCAGGGC 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1007430757 6:41775416-41775438 CACCCTGGCCTGTCTGACATCGG 0: 1
1: 0
2: 0
3: 14
4: 203
1007430751_1007430760 11 Left 1007430751 6:41775385-41775407 CCTATCCCAGGGTGGAGCAGGGC 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1007430760 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430751 Original CRISPR GCCCTGCTCCACCCTGGGAT AGG (reversed) Intronic
900177661 1:1297981-1298003 CCCCCGCCCCACCCTGGGCTGGG + Intronic
900185502 1:1331382-1331404 GCTCTCCTGCACCCTGGGACGGG + Exonic
900593035 1:3468274-3468296 GCTCTGCTCCTCACTGGGCTGGG - Intronic
900623631 1:3598507-3598529 GCACTGCTGCAGCCTGGGAGAGG - Intronic
900721676 1:4180197-4180219 GTCCTGTTCCTCCCTGGGCTGGG - Intergenic
900787458 1:4657668-4657690 GGCTTGCTCCACCATGGGAGAGG + Intronic
901003579 1:6160931-6160953 GCCCGGCCCCTCCCTGGGAAGGG - Intronic
902682022 1:18050310-18050332 GCCCTGCTCCTCTGTGGGCTCGG - Intergenic
903255867 1:22099124-22099146 GCCCTGCTTCACCACGGCATAGG + Intergenic
904033007 1:27544832-27544854 GCCCTGCTCCACGGTGGCCTGGG + Intronic
904338439 1:29812959-29812981 CCCCTGCACCACCCTGGCTTGGG - Intergenic
905628512 1:39505068-39505090 CTCCTGCTCATCCCTGGGATTGG - Intronic
905629888 1:39512564-39512586 GCTCTGCTCCACCCCGAGAGGGG - Intronic
905630299 1:39514765-39514787 GGCCGGCTCCGCCCTGGGCTGGG - Intronic
905667460 1:39771424-39771446 GGCCGGCTCCGCCCTGGGCTGGG + Intronic
905667871 1:39773626-39773648 GCTCTGCTCCACCCCGAGAGGGG + Intronic
905967862 1:42114422-42114444 GCCCTGCCCCACCCTGGAGCAGG + Intergenic
906063866 1:42966092-42966114 GCCCAGCTCCACCTTGTGATTGG + Intergenic
906156161 1:43615246-43615268 GCCCTGCTCCACACAAGGCTGGG + Intronic
907377035 1:54052789-54052811 GTCCTGCACTACCCTGTGATAGG - Intronic
908463182 1:64366285-64366307 CCCCTGCTTCTCCCTGGGAAAGG - Intergenic
912519217 1:110233875-110233897 TCCCTGCTCCTCCCTGGTGTTGG + Exonic
912796247 1:112695345-112695367 GCCCTGCCCCAGCCTGGGTACGG + Intronic
914935601 1:151976983-151977005 GTCCTGCCCCACTCTGGGATGGG - Intergenic
915226304 1:154414336-154414358 GCCCTGCCCCACCCTGTGCCTGG + Intronic
915488499 1:156238723-156238745 GCCCTGCTGCAGCTTGGGAAGGG + Intronic
915937456 1:160097868-160097890 CCCCATCTCCACCCTGGGTTGGG - Intronic
916468169 1:165093076-165093098 CTCCTGCTCCTCCCTGGGAATGG + Intergenic
918238886 1:182604456-182604478 GCCCAGCCCCACCCTCCGATTGG - Intergenic
918657669 1:187048249-187048271 GCCCTGCAACAGGCTGGGATGGG + Intergenic
920202064 1:204265815-204265837 GGCCCTCTCCTCCCTGGGATTGG + Intronic
921908916 1:220527466-220527488 GCCCTGCAGCACCCTCGGAGTGG - Intergenic
922315249 1:224435400-224435422 ACTCTGCTCCACCCTGGGAAGGG + Intronic
923095031 1:230768387-230768409 CTCCAGCTCCACCCTGGGACTGG + Intronic
1062864917 10:844134-844156 GCCCTGCTCCACCCTCATCTCGG + Intronic
1062968627 10:1629333-1629355 GCCATGCTGTCCCCTGGGATTGG + Intronic
1066961389 10:42230789-42230811 GCCCTGCCCCACCTTGGCCTTGG - Intergenic
1068121704 10:52787201-52787223 GCCATGCTCTACCCTGGGATGGG - Intergenic
1070153531 10:73819621-73819643 GCCCCGCTCCGCACTGGGAATGG - Exonic
1070666977 10:78351896-78351918 GCCCTCCTCCATCCTCAGATTGG + Intergenic
1071491829 10:86141363-86141385 GCCCTGCTACTCCCTCTGATTGG - Intronic
1071877009 10:89852944-89852966 TCTCTGCTCCAACTTGGGATTGG - Intergenic
1072172375 10:92878078-92878100 GCCCTGCTCAGCCTTGGGAGTGG + Intronic
1072432148 10:95382412-95382434 TCCCTGTTCCACACTGGAATAGG + Intronic
1072611113 10:97018310-97018332 GCCCTGCTCAACCCTGGAGCTGG + Intronic
1073378887 10:103062644-103062666 GCCCTCCACAGCCCTGGGATGGG - Intronic
1074121788 10:110498569-110498591 GCCCTCCTACACCCTGGGACCGG + Intronic
1074452079 10:113567557-113567579 GCCCAGAACCAGCCTGGGATTGG - Intronic
1074780160 10:116796746-116796768 GCCCAGCCCCACCCTTGGATGGG + Intergenic
1074880419 10:117652784-117652806 TCTCTGCTCCAACCTGGGAGGGG + Intergenic
1075274441 10:121080598-121080620 GGGCTGCCCCACCCTGGGACAGG - Intergenic
1075552171 10:123400749-123400771 CCCCTACTCCACCCTGGGCATGG - Intergenic
1075717539 10:124565827-124565849 GCCCTGCTCCAGCCCGGCGTCGG + Intronic
1075788851 10:125068976-125068998 TCCCTGCCCCAGCCTGCGATGGG - Intronic
1076190447 10:128479590-128479612 GGGCTGCTCCTCCCTGGGACTGG + Intergenic
1076865350 10:133163889-133163911 TCCCTCCTCCCACCTGGGATGGG + Intronic
1076865369 10:133163943-133163965 TCCCTCCTCCCACCTGGGATGGG + Intronic
1076865405 10:133164051-133164073 TCCCTCCTCCCACCTGGGATGGG + Intronic
1077286004 11:1766266-1766288 GCCCTGGTCCTGCCTGGCATGGG + Intergenic
1078721756 11:13891002-13891024 ACGCTGCTCCACCCTGGAAGGGG - Intergenic
1080614960 11:33937735-33937757 CCCCTGCTCCAGCCTGGGCTTGG + Intergenic
1080763662 11:35276374-35276396 TCCCAGCTCCAGCCTAGGATGGG + Intronic
1081487982 11:43546767-43546789 TCCCTCCTCCAGCCTGGGGTTGG - Intergenic
1081808922 11:45904579-45904601 TCCCTTCTCCTCCCTTGGATGGG + Intronic
1083040594 11:59681652-59681674 CTCCTGCTCCTCCCTGGGAATGG + Intergenic
1083203469 11:61133553-61133575 ACCCTACGCCATCCTGGGATGGG + Intronic
1083305083 11:61757895-61757917 GCTCTGTGCCAGCCTGGGATGGG + Intronic
1083609660 11:63998898-63998920 GCCCCGGTCCACCCTGGGGGCGG - Intronic
1083663233 11:64261777-64261799 GCCCTCCTGCACCCTGGCCTGGG + Intronic
1083679508 11:64344681-64344703 GCCAGGCTCTCCCCTGGGATTGG - Exonic
1083852731 11:65377488-65377510 GACCTCCTTCACCCTGGGAAAGG - Intronic
1084330228 11:68425772-68425794 GCCCTGCTCCCACCTGGGCTGGG - Intronic
1084580795 11:70022017-70022039 GTCCTGCTTCTCCCTGGGGTTGG + Intergenic
1089152034 11:116371765-116371787 GCCCTGCCCAGCCCTGGGACAGG + Intergenic
1089172925 11:116527796-116527818 GACCTGCTCCAATCTGGGAGTGG + Intergenic
1089730428 11:120515546-120515568 CCCCTGCTCCTACCTGGTATTGG + Intronic
1089775485 11:120832608-120832630 GCCCTGCTCCACTCAGGGCTGGG - Intronic
1090184488 11:124727585-124727607 GCTCTGCTCCCCTCTGGGAAAGG - Intergenic
1092112629 12:5974535-5974557 GCCCAGCTCAGCCCTTGGATCGG - Intronic
1092526209 12:9311764-9311786 GCCCTGCTCCTCTCTGTGGTTGG + Intergenic
1092541067 12:9420026-9420048 GCCCTGCTCCTCTCTGTGGTTGG - Intergenic
1094511977 12:31102460-31102482 GCCCTGCTCCTCTCTGTGGTTGG + Exonic
1094524985 12:31225543-31225565 GCCTTGAGCCAACCTGGGATGGG + Intergenic
1096918196 12:55056116-55056138 TCCCTCCTCCACCCTCTGATAGG + Intergenic
1097849016 12:64393197-64393219 GCCCTACTCCACTCTGGCCTGGG + Intergenic
1102565298 12:113793607-113793629 GCCCTGCTCCACCCAGCTACAGG + Intergenic
1104713573 12:131002783-131002805 CCCCAGGTCCACTCTGGGATGGG - Intronic
1109061727 13:57630032-57630054 GCCTTGCTCCTCGCTCGGATTGG + Intergenic
1110382954 13:74875645-74875667 GCCCCTCTCTACCCTGGGCTGGG + Intergenic
1113912771 13:113852050-113852072 GCCCTGCTTCACCCAGGGACGGG - Intronic
1114533058 14:23407331-23407353 CCTCTCCTCCACCCTGGGAGAGG + Intronic
1118346216 14:64942955-64942977 ACCCTGCTGCAACCTGGGAAGGG + Intronic
1119633654 14:76256568-76256590 GCCCAGCCCCATCCTGGGAGAGG - Intergenic
1119735085 14:76976508-76976530 ACCCTGCCCCTCCCTGGGAGAGG - Intergenic
1119750881 14:77076516-77076538 GCCTGACTTCACCCTGGGATGGG + Intergenic
1120792769 14:88600235-88600257 GACATGCTCCATCCTGGGAAGGG - Intronic
1122598316 14:102908474-102908496 GCGCTGCTCCACCCTCGGCCTGG + Exonic
1122689538 14:103525389-103525411 CTCCTGCTCCTCCCTGGGAATGG - Intergenic
1122871446 14:104640792-104640814 TGCCTGCTCCACCCTCGGAGGGG + Intergenic
1123055679 14:105568554-105568576 GCCCGGCTCCCCCCTGGGCTGGG - Intergenic
1123080038 14:105688073-105688095 GCCCGGCTCCCCCCTGGGCTGGG - Intergenic
1128398674 15:67254773-67254795 GGCCTGTTCCACGCTGGGAGCGG - Intronic
1128632813 15:69282735-69282757 GCTCTGCTCTTCCCTGGGCTGGG - Intergenic
1129170039 15:73801985-73802007 GCCCAGCCACACTCTGGGATAGG - Intergenic
1129452239 15:75657571-75657593 GGCCTGCTGCACCCTTGGGTCGG + Exonic
1129454736 15:75670608-75670630 GCCCTGCTCCTCCATGGGGGAGG + Intergenic
1130255667 15:82325022-82325044 CCTCTGCTCCTTCCTGGGATTGG - Intergenic
1130679551 15:85984453-85984475 GCTCTCCTCCCTCCTGGGATGGG - Intergenic
1131508558 15:93036447-93036469 TTCCTGCTCCACCCTGGGGAGGG + Intronic
1132149113 15:99447280-99447302 GCCCAGCTCAGCCCTGGAATTGG + Intergenic
1132587072 16:710241-710263 CCCCAGCTCCACCCAGGGAGGGG + Intronic
1132807100 16:1779894-1779916 TCCCTGCTCCAGCCAGGGAGAGG - Intronic
1133013503 16:2928212-2928234 CCCCTGCTCGTCCCTGGGAATGG - Intronic
1133383746 16:5352225-5352247 GCGCTTGTCCACCCTGGGAGTGG + Intergenic
1134627139 16:15730242-15730264 CCACTGCACCACCCTGAGATTGG - Intronic
1136355234 16:29740733-29740755 GTCCTGCTCGTCCCTGGGAACGG + Intergenic
1136419352 16:30122589-30122611 GCCCTGCCCCACCCTGATCTCGG + Intronic
1137300651 16:47144420-47144442 GCCTTGCTCGACCCTGGGCAGGG + Intergenic
1137954909 16:52819544-52819566 GCCCTGCTTCACCGTGACATAGG + Intergenic
1138473567 16:57257502-57257524 GCCCTGCCCTCCCCTGGGCTTGG + Intronic
1138567803 16:57846204-57846226 GCCCAGCCCCACCCAGGGAGAGG - Intronic
1139062000 16:63263839-63263861 GCTCTGCCCTTCCCTGGGATGGG - Intergenic
1139852364 16:69959044-69959066 GCCCTGCTACACCCTCTGCTGGG + Intronic
1139881335 16:70181952-70181974 GCCCTGCTACACCCTCTGCTGGG + Intronic
1139905177 16:70360361-70360383 GCCCCGCTGCACTCTGGGCTGGG - Intronic
1141581930 16:85005179-85005201 GCTCTGCTCTTCCCTGGGACAGG - Intronic
1142141469 16:88474542-88474564 GCCCTGCACGGCCCAGGGATGGG - Intronic
1142901301 17:3013403-3013425 GCCCTGCTCCACTCCTGGGTCGG + Intronic
1142997527 17:3769602-3769624 GCCCTGTTACACCCTGAGCTGGG + Intronic
1143149933 17:4801512-4801534 TCCCTCCTCAACCCTGGGTTGGG - Intergenic
1143180777 17:4982696-4982718 GCCCTCCTCCACCCTTAGCTGGG - Intronic
1144953313 17:19005251-19005273 GCCCTGATCCCCTCTGGGAGGGG + Intronic
1145058282 17:19717049-19717071 GCCCTGCTTTTCCCTGGGAGGGG + Intronic
1145996444 17:29107390-29107412 GGCCTGCTCCACAGGGGGATAGG + Intronic
1146788825 17:35740208-35740230 GACCTGCTCCATCCTGGCTTGGG + Intronic
1147050013 17:37787221-37787243 GCTCAGCTCCAGCCAGGGATGGG - Intergenic
1147958673 17:44152841-44152863 GCCCTACTCCACCTTAGGAAGGG + Intronic
1148687899 17:49510803-49510825 GACCTGCTGCACCCTGGAGTGGG - Intronic
1149478831 17:56985518-56985540 GCCCTGCCCAACTCTGGGAGGGG + Intronic
1149639275 17:58192672-58192694 GCCCTCCCCCACCCTAGAATGGG + Intergenic
1150103917 17:62447904-62447926 ACCCTCTTCCACCCTGGGCTAGG + Intronic
1151290602 17:73147176-73147198 CTCCTGCTCCAGCCTGGGAGTGG - Intergenic
1152623691 17:81378965-81378987 GGCCTGCTGCACCCTGGGGAGGG - Intergenic
1153978345 18:10288834-10288856 GCCCTGCTGCCACCTGGGCTAGG + Intergenic
1155342153 18:24823658-24823680 GCCCTGTTCCACCTTGGCCTGGG - Intergenic
1156510218 18:37630161-37630183 ACCCAGCTCCACACTGTGATAGG + Intergenic
1157446016 18:47747533-47747555 GCTCCTCTCCACCCTGTGATTGG + Intergenic
1158324520 18:56299685-56299707 GCCCTGTCCCTCCCTTGGATGGG - Intergenic
1160212501 18:76894261-76894283 GTCCTGCTCCATCCTGAGAGGGG + Intronic
1160980591 19:1814965-1814987 GCCCAGCTCCACACAGGGCTGGG + Intergenic
1162823617 19:13237791-13237813 ACCCAGCTCCACCTGGGGATGGG + Intronic
1163560098 19:18013989-18014011 GCCCTGCCCCAGCCAGGGCTGGG - Exonic
1164486088 19:28656950-28656972 GCCCTGCTACACCATGGTCTCGG - Intergenic
1165828748 19:38720130-38720152 GGCCTCCTCCGCCCTGGGGTGGG + Intronic
1166066216 19:40360640-40360662 GCCCTGCTACACCTTGAGTTTGG - Intronic
1166590748 19:43996247-43996269 GTCCTGCTTCAACCTGGGAGGGG - Exonic
1167827054 19:51983451-51983473 CTCCTGCTCCTCCCTGGGAATGG + Intronic
1167913734 19:52724031-52724053 CTCCTGCTCCTCCCTGGGAATGG - Intronic
1167931938 19:52873109-52873131 CTCCTGCTCCTCCCTGGGAATGG - Intronic
1168418223 19:56183009-56183031 CCCCTGCTCCACCCTCGGGAAGG + Intronic
1168520422 19:57045995-57046017 GCCCTGCTCCTCCCAGGGGATGG - Intergenic
925860990 2:8174799-8174821 GCCCTGATGCCACCTGGGATGGG - Intergenic
926541096 2:14182541-14182563 GCCCAGCTCCACCTTGGGCCTGG - Intergenic
926758167 2:16252463-16252485 GCGAAGCTCCACCCTGGGCTGGG + Intergenic
927036093 2:19177904-19177926 GCCATGCCCCACTCTAGGATGGG - Intergenic
929458100 2:42080430-42080452 GCGCTGCTCTACCCAGGCATGGG + Intergenic
932163165 2:69481488-69481510 TCCCAGCTACATCCTGGGATGGG - Intronic
933997505 2:87680449-87680471 GCCCTACTCCACCCTGCCAAGGG - Intergenic
934737293 2:96695970-96695992 GCCCTGCTACCCCGTGGGGTTGG + Intergenic
934935993 2:98465831-98465853 TCCCGGCTCCACCCTGGTTTCGG + Intronic
935145399 2:100391957-100391979 TCCCTCCTCCACCCCGGGCTCGG + Exonic
935738097 2:106122325-106122347 CTCCTGCACCACCCTGAGATGGG + Intronic
936296347 2:111270463-111270485 GCCCTACTCCACCCTGCCAAGGG + Intergenic
937070848 2:119061945-119061967 TGACTGCTCCACCCTGGGGTGGG + Intergenic
942757094 2:179354374-179354396 GCCTTGATCCACCTTGGGGTGGG + Intergenic
945032837 2:205681822-205681844 GCTCTGCTCCTCTCTGGGTTAGG - Intergenic
946313462 2:218895522-218895544 TCTCTCCTCCTCCCTGGGATGGG - Intronic
946616675 2:221517543-221517565 GCCCTCCTCCACCCTGGTCCAGG - Intronic
947670620 2:231933451-231933473 GCCCTGCTCCTTCCTGTGACCGG + Intergenic
948330443 2:237160449-237160471 GCCTTGCCCCACCCTGGTCTTGG - Intergenic
948424837 2:237880647-237880669 GGCCTGCTGGGCCCTGGGATTGG - Intronic
948495522 2:238346224-238346246 ACTCAGCTCAACCCTGGGATGGG - Intronic
948660137 2:239501894-239501916 GCCCTGCTCCACCCTCTGTGGGG + Intergenic
948855344 2:240727704-240727726 GCCCTGAGCCACCCTGGGACAGG - Intronic
1170364217 20:15582142-15582164 TCCCTTCTCCACCCTGGCAGTGG - Intronic
1172352291 20:34252598-34252620 CTCCTGCTCCTCCCTGGGAATGG - Intronic
1172483542 20:35285490-35285512 GCCCTGCTGCACACTTGGACAGG + Intergenic
1175225330 20:57441086-57441108 TCCCTGTCCCACCCTGGGCTGGG + Intergenic
1175733078 20:61367174-61367196 GCCCTGTCCCACCCTGGCCTGGG - Intronic
1175870726 20:62208302-62208324 GCTCTGCTCCACCCTTGGCTGGG - Intergenic
1176285360 21:5016448-5016470 GCCCTCCTGCACCCAGGGCTGGG + Intergenic
1178344589 21:31814035-31814057 ATCCTTCTCCACCCAGGGATTGG + Intergenic
1179871821 21:44247027-44247049 GCCCTCCTGCACCCAGGGCTGGG - Intronic
1180061294 21:45386306-45386328 GCCCTCTCCCACCCTGGGGTCGG - Intergenic
1180157315 21:45983875-45983897 GCTCTGCCCCAGCCTGGGGTGGG - Intronic
1180972642 22:19823335-19823357 CCCCTGCTCCAGCCTGTGATGGG + Intronic
1181006178 22:20014766-20014788 TCCCTGCTCCACCCAGAGACCGG + Intronic
1181609649 22:24004042-24004064 AGCCTGCTCCACCCTAGGTTTGG + Intergenic
1181986115 22:26800864-26800886 GCCCTGCTCAAGCCTAAGATGGG + Intergenic
1182145018 22:27992246-27992268 ACCCAGCTTCACCCTGGGGTTGG + Intronic
1182145150 22:27992937-27992959 ACCCAGCTTCACCCTGGGGTTGG + Intronic
1182791926 22:32960292-32960314 GCCCTGATCACCCCAGGGATAGG + Intronic
1183343585 22:37295010-37295032 GGCCACATCCACCCTGGGATGGG + Intronic
1183829532 22:40410438-40410460 GCCCAGCTTCACCCTGCGGTGGG - Exonic
1183948433 22:41339682-41339704 GCCCTGCTCCCACATGGGACAGG + Intronic
1184259885 22:43308705-43308727 GCCCAGCTGCACCCTGGGGGAGG - Intronic
950528132 3:13536506-13536528 TCCCTTCTCCACCCTAAGATGGG + Intergenic
953135683 3:40179838-40179860 GCCCTGGTGTACCTTGGGATTGG - Intronic
953355029 3:42248703-42248725 GCCCTGATCCACCCTGCCTTGGG - Intergenic
953404499 3:42653934-42653956 GCCCTGCGCCGCCCTGGGATAGG + Intronic
953881671 3:46694176-46694198 GCCCTGCGGCCCCCTGGGCTGGG + Intergenic
954373544 3:50182838-50182860 GCCCTGCTCCAGCCAGGGCTTGG + Intronic
954633347 3:52058476-52058498 CCTCTGCTCCACCATGGGGTTGG + Intergenic
954876351 3:53805507-53805529 GCCCTGCTGCACTCTGTGATGGG + Intronic
954882701 3:53846428-53846450 GACCTGCCCCAGCCTGGGAGGGG + Intergenic
956155928 3:66296925-66296947 GCCCTGCTCCAACCTAGTGTAGG + Intronic
957165966 3:76674404-76674426 TCCCTGCTTGATCCTGGGATGGG - Intronic
960837629 3:121923566-121923588 TCCCTGCTGTACTCTGGGATAGG - Intronic
961673799 3:128552806-128552828 GCCCTCCTCCATCCTTGGCTAGG - Intergenic
962045572 3:131756519-131756541 TCCATGCTCTACCTTGGGATGGG + Intronic
962385767 3:134930961-134930983 GCCCAGCACCAGCCTGGCATAGG + Intronic
962420616 3:135225739-135225761 CCCCTCCTCCAACCTGGGACTGG - Intronic
962479803 3:135788466-135788488 GCTCTGCACCACCCTGGGGGTGG + Intergenic
962712322 3:138098389-138098411 GTGTTTCTCCACCCTGGGATGGG - Intronic
963733641 3:148994634-148994656 CCCCTGCTGCATCCTGGGAAAGG - Intronic
965341230 3:167493533-167493555 ACACTGCTCAGCCCTGGGATGGG + Intronic
965797062 3:172449976-172449998 GCCCTGCTCCTCCGTGGGGTAGG - Intergenic
966519306 3:180855504-180855526 TCCCTGCTCAACCCTGAGGTGGG - Intronic
966885908 3:184378067-184378089 GCCCTTCTCCACCCGGTGAGTGG - Exonic
968907718 4:3462395-3462417 GGCCTCCACCACCCTGGGGTTGG - Intergenic
968907785 4:3462668-3462690 GGCCTGCTCTTGCCTGGGATGGG + Intergenic
969579399 4:8055359-8055381 GACCTGCTGCCCCCTGCGATGGG + Intronic
969601948 4:8181972-8181994 GCCCCACCCCACCCTGGGAAGGG - Intergenic
969668111 4:8573877-8573899 CCCCTGTTCCACCCTGGGTGTGG + Intronic
969721599 4:8895391-8895413 CCCCTGCCCCACACTGGGAGGGG - Intergenic
969961239 4:10946775-10946797 ACCCTGCTTCAGCGTGGGATGGG - Intergenic
970394926 4:15655799-15655821 GCCCTTCGCCTCCCTGCGATTGG + Intronic
972793974 4:42398262-42398284 GCCCTGCTCCAGCCTGGCGTCGG - Exonic
975236955 4:72010078-72010100 GCCCTGCTTCACCTTGTTATTGG + Intergenic
976600700 4:86935250-86935272 GCCCTGCGCCACCCAGGGCTGGG + Intronic
976609118 4:87011136-87011158 GCCCTTCTCCACCCTGGGGCAGG + Intronic
977400432 4:96524553-96524575 CTCCTGCTCCTCCCTGGGAATGG - Intergenic
979624648 4:122830961-122830983 CCCCTGCTCCACACTGGGGTGGG - Intronic
981606581 4:146546673-146546695 GCTCTGCACCTCCCTGGGACAGG - Intergenic
981739189 4:147984870-147984892 GCCCTGCTCCAACCTGGAGGAGG + Intronic
984953654 4:185024770-185024792 GCCCTGCTTCAAGCTGTGATTGG + Intergenic
985549721 5:526868-526890 GCGCTGCCCCAGCCTGTGATGGG + Intergenic
985685393 5:1279242-1279264 GCCCTGCTGGACCTTGGGAGTGG - Intronic
985704036 5:1390465-1390487 GCCCTGGGCCACCCTGGCACAGG + Intergenic
986311320 5:6553112-6553134 GCCCTGTGCCACCATGGCATGGG + Intergenic
989802946 5:45566758-45566780 GCCCTTCTGCACTCTGGGACGGG + Intronic
990942924 5:61221535-61221557 ACCCTGCAAGACCCTGGGATGGG - Intergenic
992872706 5:81022716-81022738 GCCGTCCTCCTCCCTGGGAGAGG + Intronic
993279643 5:85908529-85908551 TCCCTGCTCAGCCCTGGGAGTGG - Intergenic
993279747 5:85910080-85910102 TCCCTGCTCAGCCCTGGGAGTGG + Intergenic
996394848 5:123003208-123003230 GCCCTGCTCCTCCCTAGGAAGGG + Intronic
996838275 5:127818624-127818646 CTCCAGCTCCACCCTGGGTTAGG - Intergenic
997235224 5:132268560-132268582 TCCTTCCTCCACCCTGGGCTAGG - Intronic
999004664 5:147962475-147962497 GCCCAGCTCCATCCAGGGCTAGG - Intergenic
999206464 5:149851806-149851828 GCCCAGAACCACCATGGGATGGG + Exonic
999817523 5:155192486-155192508 GCCCTGCTCCAAACTGGAGTGGG + Intergenic
1001313863 5:170629395-170629417 GACCTGCTCCACCCTTAGAGGGG + Intronic
1002327817 5:178420982-178421004 GCCCTGCGGCTCCCTGGGGTTGG - Intronic
1003068643 6:2926198-2926220 CTCCTGCTCCTCCCTGGGATTGG - Intergenic
1005730019 6:28687858-28687880 CTCCTGCTCCTCCCTGGGAATGG + Intergenic
1006359619 6:33579958-33579980 TCCCTGCCCCACCCTGGGGCTGG + Intronic
1007430751 6:41775385-41775407 GCCCTGCTCCACCCTGGGATAGG - Intronic
1010465765 6:76165758-76165780 ACCCTGCACTTCCCTGGGATGGG + Intergenic
1011611871 6:89159921-89159943 GGCCTGCTCTACCCCGGGTTTGG + Intronic
1011786968 6:90857846-90857868 GACCTGCTCCAGACTGGGAGAGG - Intergenic
1013956671 6:115850068-115850090 CCCCTGCCCCACCCTACGATAGG - Intergenic
1014913064 6:127117351-127117373 GCTCTGGCCCACCCAGGGATGGG - Intergenic
1015285242 6:131479150-131479172 CTCCTGCTCCTCCCTGGGAATGG + Intergenic
1019067051 6:169311093-169311115 GCCATGGTCCTCCATGGGATGGG + Intergenic
1022089663 7:27099144-27099166 GCCCTGCTCCGCGCTGAGCTTGG + Intergenic
1026928115 7:74207751-74207773 GCCCTGCTCCACCCCAGCCTTGG + Intronic
1029020158 7:97356913-97356935 GCCTTGCTCCATCCAGGGCTGGG + Intergenic
1032033099 7:128501101-128501123 ACCCTCTTCCACCCTGGGCTAGG + Intronic
1033668698 7:143468798-143468820 GCACTGCTGCACTCTGGCATGGG - Intergenic
1034338314 7:150337448-150337470 GCCTGGCTCCACCCAGGGCTGGG - Exonic
1034472458 7:151262691-151262713 GCCCTGCCCCACCCTGTTAGGGG - Intronic
1036833966 8:12043112-12043134 GCCCCTCTCCCCCCTGCGATGGG + Intergenic
1036855812 8:12289677-12289699 GCCCCTCTCCCCCCTGCGATGGG + Intergenic
1037989175 8:23308436-23308458 GCCCTTCTCCACACTTGGATGGG - Intronic
1039846218 8:41327333-41327355 GCCTTGCTCCAACCTGTGAAGGG + Intergenic
1040825706 8:51618603-51618625 AACCTGCTCCTCCCTGGGAGAGG - Intronic
1041520074 8:58746177-58746199 GCACTGCTCCACCCAGAGAATGG + Intergenic
1042194508 8:66220975-66220997 GCCATGCTCAGCCCTGGGCTGGG + Intergenic
1045013862 8:97981828-97981850 TGCCTGCACCACCCTGGGCTGGG - Intronic
1046778545 8:118190373-118190395 GGTCTTCTCCAACCTGGGATTGG + Intronic
1046791397 8:118326121-118326143 GCCCTGCTCCACTGTTGAATTGG + Intronic
1049245901 8:141562381-141562403 AGCCTGCTCCAGCCTGGGCTTGG - Intergenic
1049337166 8:142092587-142092609 GCCCTGCTCCAACGTGGGTTGGG - Intergenic
1049463840 8:142742148-142742170 GCCCAGCTTCACCCTGGGACAGG - Intronic
1051312974 9:15796628-15796650 TCCCTGCTCAACCCTGCGGTTGG + Intronic
1053566493 9:39258084-39258106 GCACTGTCCCAGCCTGGGATGGG - Intronic
1053832272 9:42095944-42095966 GCACTGTCCCAGCCTGGGATGGG - Intronic
1054130653 9:61360928-61360950 GCACTGTCCCAGCCTGGGATGGG + Intergenic
1054598274 9:67091476-67091498 GCACTGTCCCAGCCTGGGATGGG + Intergenic
1054844133 9:69774833-69774855 GCCCTGCTGCACCCTAGCCTGGG - Intergenic
1055656330 9:78453459-78453481 GTCCTGCTGCATCCTGGGCTGGG + Intergenic
1055920523 9:81455420-81455442 GCCCTGCCCTGCCCTGGGATGGG + Intergenic
1056124505 9:83521967-83521989 GCCCTAATCCAGCCTGGGAAGGG - Intronic
1056754418 9:89373055-89373077 GCCCTGTCCCTCCCTTGGATGGG + Intronic
1056825531 9:89874032-89874054 GCCCTGGGCCACCCTTGGACAGG + Intergenic
1056828343 9:89891995-89892017 GCCAGAGTCCACCCTGGGATAGG - Intergenic
1056990480 9:91405917-91405939 GCGCTGCTCCCCACTGCGATTGG + Intergenic
1057182375 9:93037068-93037090 TCCCTGCTCCAGCCTGAGCTGGG - Intergenic
1057618216 9:96612524-96612546 TCTGTGCTCAACCCTGGGATGGG + Intronic
1057815344 9:98290107-98290129 GCCCTTCTCCACTCTGGGGGAGG - Exonic
1058890140 9:109354448-109354470 GCCTTGGGCCACCCTGGGAGGGG - Intergenic
1058963583 9:110015674-110015696 CCTCTTCTCCACCCTGGGCTAGG + Intronic
1059769753 9:117414491-117414513 GCCCTTCTTCACCCTGGGTAAGG - Exonic
1060228819 9:121812459-121812481 GCTCTGCTCCGGCCTGGGAAGGG + Intergenic
1060658342 9:125388101-125388123 GCCGTTCTCCACCCTGCGCTTGG - Intergenic
1061028157 9:128063863-128063885 GCCCTCCTCCAGCGTGTGATAGG + Exonic
1061033828 9:128102550-128102572 CCCCAGCTGCACTCTGGGATGGG - Intronic
1061237492 9:129351386-129351408 GCCCAGCTCCAACCTGGGGAGGG + Intergenic
1061871714 9:133524446-133524468 GCCCTGCTTCACCCCAGGCTTGG + Intronic
1062145585 9:134988013-134988035 GGCCTTCCCCACCCTGGGAATGG + Intergenic
1062407697 9:136404762-136404784 GCCCTCCTGCTCCCTGGGTTGGG - Intronic
1062678360 9:137761983-137762005 GCCCTGCCCCAGCCCCGGATGGG - Intronic
1193170377 X:78329130-78329152 CTCCTGCTCCTCCCTGGGAATGG + Intergenic
1195934296 X:110110471-110110493 GCGCTGCCCCACCCTTGGAGAGG + Intronic
1197713445 X:129688603-129688625 GCCATGAGCCACCCTGTGATTGG - Intergenic
1199294069 X:146137829-146137851 GCCCTGGTTCACCATGGTATTGG - Intergenic