ID: 1007430753

View in Genome Browser
Species Human (GRCh38)
Location 6:41775390-41775412
Sequence ACCAGGCCCTGCTCCACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 456}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430753_1007430762 19 Left 1007430753 6:41775390-41775412 CCCAGGGTGGAGCAGGGCCTGGT 0: 1
1: 0
2: 5
3: 44
4: 456
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430753_1007430757 3 Left 1007430753 6:41775390-41775412 CCCAGGGTGGAGCAGGGCCTGGT 0: 1
1: 0
2: 5
3: 44
4: 456
Right 1007430757 6:41775416-41775438 CACCCTGGCCTGTCTGACATCGG 0: 1
1: 0
2: 0
3: 14
4: 203
1007430753_1007430760 6 Left 1007430753 6:41775390-41775412 CCCAGGGTGGAGCAGGGCCTGGT 0: 1
1: 0
2: 5
3: 44
4: 456
Right 1007430760 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 113
1007430753_1007430763 27 Left 1007430753 6:41775390-41775412 CCCAGGGTGGAGCAGGGCCTGGT 0: 1
1: 0
2: 5
3: 44
4: 456
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430753 Original CRISPR ACCAGGCCCTGCTCCACCCT GGG (reversed) Intronic
900114140 1:1021316-1021338 ACCAGGCCCTCCCCCTGCCTGGG + Intronic
900181098 1:1311297-1311319 ACCAGACCCTGCGTCAGCCTGGG - Intronic
900344246 1:2203563-2203585 ACCTGCCCCAGCTCCACCCCAGG - Intronic
900494243 1:2969263-2969285 ACCAGTGCCTGCTTCACCCTGGG + Intergenic
900523321 1:3116542-3116564 ACCAGGCACTGCCCCAGCCGGGG - Intronic
901041781 1:6368479-6368501 CCCAGGCCCAGCTCCACCTTGGG + Intronic
901185504 1:7370138-7370160 ACCAGTCCCTGCTGCCCCCGCGG - Intronic
901873699 1:12153679-12153701 TCCAGGCCATGCTGCCCCCTGGG - Intergenic
901934578 1:12618605-12618627 CCCCGGGCCTGCTCCACACTCGG - Intergenic
902422654 1:16293601-16293623 ACAAAGCCCAGCTCCACCCATGG + Intronic
902454333 1:16521145-16521167 ACCAGACCCTGCTCCCCGCGAGG - Intergenic
902498119 1:16889172-16889194 GCCAGACCCTGCTCCCCCCGAGG + Intronic
903283361 1:22262768-22262790 ACCAGGCCCGGCCCCACCCAGGG - Intergenic
903387397 1:22936486-22936508 CCCAGGCCCAGCCCCAGCCTTGG + Intergenic
903527405 1:24002178-24002200 ACCAGGCCCACCTCCAACATTGG + Intergenic
904295532 1:29517629-29517651 TCCAGGCTCTGCACCACCCCAGG - Intergenic
904443666 1:30550599-30550621 CCCAGGCCCAGCTCCGCCTTGGG - Intergenic
904657942 1:32063236-32063258 ACCAGGCCCAACTCCTTCCTGGG - Intergenic
904895896 1:33818012-33818034 AACCAGCCCTTCTCCACCCTTGG + Intronic
905336940 1:37251217-37251239 CCCAAGCCCTGATCCAGCCTGGG + Intergenic
905356686 1:37389811-37389833 ACCCGGCCCTTCTGCATCCTGGG + Intergenic
906052517 1:42887065-42887087 GCCAGGCACTGCTCCGGCCTTGG - Intergenic
906150130 1:43582796-43582818 ACCTGCCCCGGCCCCACCCTCGG + Intronic
906670426 1:47650344-47650366 ACCAGGCCCTGGAGCACACTTGG + Intergenic
908176545 1:61561150-61561172 AGCAGGTCCTGCTCCTCCATTGG + Intergenic
908613668 1:65892599-65892621 CCCAGTCCCTGCTTCTCCCTAGG + Intronic
911362775 1:96900045-96900067 ACCAGGTCCTGCTTCCCCCTTGG + Intergenic
912086751 1:106015334-106015356 ACCAGGCCCACCTCCAACATTGG + Intergenic
912174306 1:107139120-107139142 ACCAGGCCCTCCTTGGCCCTGGG - Intergenic
913486488 1:119336346-119336368 ACCTGGCACGGCACCACCCTGGG - Intergenic
916513574 1:165495198-165495220 ACCATCACCTGCTCCTCCCTTGG - Intergenic
916817552 1:168368429-168368451 CCCAACCCCTGCTCCACACTGGG - Intergenic
917297461 1:173536512-173536534 TCCAGAGCCTGCTCCACCCCAGG + Intronic
917841483 1:178983462-178983484 ACCAGGCCCTACTCCAACACTGG - Intergenic
918095499 1:181330563-181330585 AGCAGGCCTTGCCCCACCCAAGG - Intergenic
920528411 1:206685080-206685102 ACCCGGCCCGGCTCCAGGCTCGG - Exonic
920945888 1:210528209-210528231 ACCAGCCCCTGCACCACCCCTGG - Intronic
922359103 1:224804841-224804863 ACCAGTACCTGTCCCACCCTTGG + Intergenic
922671320 1:227510368-227510390 CCCAGCCCCTGCTCCCTCCTGGG - Intergenic
922886475 1:229024648-229024670 ACCAGGACCTGCTCCACCTGAGG + Intergenic
923295535 1:232591415-232591437 ACCAAACCCAGCTCCTCCCTGGG + Intergenic
923898923 1:238304378-238304400 ACCAGGCCCCACTCCAACATTGG - Intergenic
924141516 1:241028670-241028692 TCCAGTCCCTGCGCCTCCCTGGG - Intronic
924243755 1:242062348-242062370 CCCAGCCCCTGCTCCCTCCTGGG - Intergenic
924369905 1:243336670-243336692 ACCAGGCCCCCCTCCAACATCGG + Intronic
1063217337 10:3936675-3936697 ACCAGGCCCACCTCCAGCATTGG - Intergenic
1063649446 10:7918550-7918572 ATCAGGCCCAACTCCACCCCAGG - Intronic
1064124714 10:12650107-12650129 AGCAGTCCCTCCTCTACCCTTGG + Intronic
1065196703 10:23273783-23273805 ACCAAGTCCTGCTCCACTTTTGG + Intronic
1065938394 10:30542044-30542066 ACTGGCCCCTGCTCCCCCCTCGG + Intergenic
1066325122 10:34351286-34351308 ACCAGTGCCTGCTCTACGCTAGG - Intronic
1066676200 10:37890013-37890035 ACCAGGCCCACCTCCAGCATTGG + Intergenic
1067205390 10:44208015-44208037 GCCAGGCACTCCTCCAGCCTTGG - Intergenic
1067321865 10:45228876-45228898 ACCAGGCCCACCTCCAACATTGG - Intergenic
1067760274 10:49039648-49039670 ACCATGCCCTCCTCCACAATGGG - Intronic
1067843540 10:49700690-49700712 CCCAGGCCTTCCTCCACCCTAGG - Intronic
1068257974 10:54538616-54538638 ACCAGCCCCTCCTCCAACATTGG - Intronic
1068340758 10:55699312-55699334 ACTAGGCCCTTCTCCAACATTGG - Intergenic
1069626082 10:69868420-69868442 TCCACTCCCTGCCCCACCCTGGG - Intronic
1070299015 10:75189401-75189423 GCCAAGCCCTGTTCCACCCAAGG - Intergenic
1070665037 10:78336719-78336741 TCCCTGCCCTGCTCCAGCCTGGG - Intergenic
1074156282 10:110802727-110802749 ACCTGGCCCAGTTCCACCCACGG - Intronic
1074248093 10:111714375-111714397 TCCAGGCCCAGCTCCACCTTGGG + Intergenic
1074574937 10:114659826-114659848 AGAAGACCCGGCTCCACCCTAGG - Intronic
1074870970 10:117575856-117575878 ACCCTGCCCTGCCCCACCCTGGG + Intergenic
1074902489 10:117831096-117831118 ATTAGGCCCTGCACCACTCTCGG - Intergenic
1075572050 10:123553122-123553144 ACCAGCCCCTGCTCCACCCATGG - Intergenic
1075844196 10:125532018-125532040 ACCATCCCCTCCTCCAACCTGGG + Intergenic
1076158485 10:128222465-128222487 ACCATGGGCTGCTCCACCATCGG + Intergenic
1076190446 10:128479585-128479607 AACAGGGGCTGCTCCTCCCTGGG + Intergenic
1076798748 10:132811115-132811137 GCCATGCCCTGCTGCGCCCTTGG - Intronic
1076918678 10:133440236-133440258 CCCAGGCCATGCACCACCCCGGG + Intergenic
1077107030 11:846635-846657 GCAAGGCCCTCCTCCACCATGGG - Intronic
1077140302 11:1021277-1021299 CCCTGGCCGTTCTCCACCCTAGG - Exonic
1077189474 11:1249853-1249875 CCCATCCCCTCCTCCACCCTTGG + Exonic
1077298693 11:1837645-1837667 ACCGGTCCCTGCTTGACCCTCGG + Intergenic
1077435613 11:2537502-2537524 AAAAGGCCCTGCGCCAACCTGGG - Intronic
1077470829 11:2759810-2759832 GCCAGCCCCTCCTCCACCCTGGG + Intronic
1078524041 11:12087006-12087028 AGTGTGCCCTGCTCCACCCTGGG + Intergenic
1078886972 11:15510240-15510262 AACAGACGCTGCTCCAGCCTGGG - Intergenic
1079093731 11:17497780-17497802 ACCAGCCCCTCCTTCATCCTGGG + Intronic
1079358974 11:19754475-19754497 ACCATGCCTTGCTCCTGCCTAGG - Intronic
1081713093 11:45230527-45230549 ACCTGGCCCAGCCCCAGCCTTGG + Intronic
1081784029 11:45733731-45733753 CCCAGGCCCTGCATGACCCTGGG + Intergenic
1081809245 11:45906018-45906040 ACACGGCCCTGCCCCATCCTGGG + Exonic
1083149984 11:60785827-60785849 ACAAGTCCCTTCTCCTCCCTGGG - Intronic
1083603062 11:63960977-63960999 GCCAGGCCCTGCACCTCTCTGGG + Intergenic
1084190401 11:67496034-67496056 ACCAGGCGCTCCTTCCCCCTGGG - Intronic
1084534908 11:69750914-69750936 TCCAGGCCCTGCTGCATGCTGGG + Intergenic
1087072304 11:94093263-94093285 ACCAGTCCATGGCCCACCCTTGG - Intronic
1089467943 11:118697629-118697651 ACAAGGCCCTGCTCCAGACTTGG + Intergenic
1089617335 11:119702255-119702277 ACCAGGGCCTCCACCTCCCTCGG + Intronic
1092687818 12:11071215-11071237 TCCAGGCTCTGCTCCACTCTAGG + Intronic
1094813328 12:34162694-34162716 CCCAGCCCCTGCTCCCTCCTGGG + Intergenic
1095103586 12:38205831-38205853 CCCAGCCCCTGCTCCCTCCTGGG - Intergenic
1096220169 12:49824124-49824146 ACCAGGCCCTGCTGCAGCCTAGG - Intronic
1096530182 12:52237487-52237509 ACCAGGCCCTCCTCTACTGTAGG + Exonic
1097079955 12:56422658-56422680 TCCAGTCCCTGCTCCTCTCTTGG + Intronic
1097174697 12:57135950-57135972 TCCATGCCCTGCTCCTCCCAGGG - Intronic
1097224470 12:57469228-57469250 GCCAGTCCGTGCTCCAGCCTAGG + Intronic
1098614778 12:72508763-72508785 ACCAGGCCCTCCTCCAACACTGG - Intronic
1099859251 12:88207447-88207469 ACCAGGCCCACCTCCAACATTGG + Intergenic
1100243837 12:92736713-92736735 AGCAGGCCCTGCTCAGTCCTGGG - Intronic
1101587916 12:106101155-106101177 ACCTGCCCCTGCTGCAACCTGGG - Intronic
1102707605 12:114895751-114895773 CCCAGGCTATGCTCCACTCTTGG + Intergenic
1104706147 12:130948953-130948975 GCCAGAGCATGCTCCACCCTGGG - Intergenic
1104764181 12:131315833-131315855 ACCAAGGCCTGGTCCACCCCTGG + Intergenic
1104774553 12:131383818-131383840 ACCAGAGCCTGCCCCACCCCTGG - Intergenic
1104894823 12:132158965-132158987 AGAGGCCCCTGCTCCACCCTCGG - Intergenic
1104981948 12:132577160-132577182 CCCAGGCCCAGGTCCACCCTGGG - Intronic
1106101380 13:26697105-26697127 ACCCTCCCCAGCTCCACCCTGGG + Intergenic
1106383886 13:29265840-29265862 ACCAGGCCCACCTCCACACTGGG + Intronic
1109576414 13:64264430-64264452 ACCAGGTCCTCCTCAACACTTGG - Intergenic
1110920496 13:81078077-81078099 ACCAGGCCCTCCTCCAACACTGG + Intergenic
1112366906 13:98763093-98763115 ACCAGGGGCTGCTGCGCCCTAGG + Intergenic
1113007415 13:105722724-105722746 GCCAGGCCATGCTCCTCTCTGGG + Intergenic
1113499836 13:110764478-110764500 ACCAGGCCCTACTCCAACATCGG - Intergenic
1113546206 13:111153391-111153413 ACAAGGCCCGGCTCCGCGCTCGG - Intronic
1114321899 14:21553935-21553957 CACAGGCCCTGCTTCTCCCTGGG + Intergenic
1117335832 14:54756550-54756572 ACCAGGCACTGTTACACACTGGG - Intronic
1118461581 14:65992255-65992277 ACCAGGCCCTCCTCCAACACTGG + Intronic
1119417312 14:74481126-74481148 ACCAGGCCCACCTCCAACATTGG - Intronic
1120674415 14:87404452-87404474 ACCAGGCCCACCTCCAACATTGG - Intergenic
1121251922 14:92505926-92505948 ATCATGCCCTCCTTCACCCTGGG - Intergenic
1121254697 14:92522718-92522740 AGCAGGCTCTGCTTCACTCTTGG - Intronic
1121316606 14:92964646-92964668 ACCAGCCTGGGCTCCACCCTTGG + Intronic
1121427166 14:93860546-93860568 CCCAGGCCCTGCTGTACCATTGG + Intergenic
1122202851 14:100132989-100133011 ACCAGACACTGCTCCACCCTTGG + Intronic
1122598314 14:102908469-102908491 GCCTTGCGCTGCTCCACCCTCGG + Exonic
1122695665 14:103550965-103550987 CCCAGGCGGTGCTGCACCCTGGG + Intergenic
1122772192 14:104102481-104102503 CCCAGGCCCTTCCCCACCCCTGG + Intronic
1122785136 14:104160061-104160083 CCCAGCCCCTGCTCTGCCCTTGG + Intronic
1122871443 14:104640787-104640809 CCTAGTGCCTGCTCCACCCTCGG + Intergenic
1122925612 14:104898103-104898125 GCCAGGCCCAGCCCTACCCTAGG - Intergenic
1122938689 14:104971683-104971705 ACCTCACCCTGCTGCACCCTGGG + Intronic
1122984931 14:105207657-105207679 ACCAGACCATGCTGCAGCCTCGG - Intergenic
1124074757 15:26434016-26434038 ACCAGGCCCAGGTCCTCCTTGGG - Intergenic
1124126830 15:26944440-26944462 GCCAGGCCTTCCTCCAACCTGGG - Intronic
1124705008 15:31956525-31956547 ACCATGCACTGCTCTGCCCTAGG + Intergenic
1125725714 15:41867161-41867183 GCCAGGCCCTGCCCCAGCCCAGG - Intronic
1125745907 15:41997033-41997055 CCCAGGCCCTGCCCTACCCCAGG - Intronic
1125751741 15:42033796-42033818 ACCAGGGCCCACTCCACCCAGGG - Intronic
1125921584 15:43528580-43528602 CCCAGGCCCTGCCCCAGCCAAGG + Exonic
1126049344 15:44672432-44672454 ATCTGACCCAGCTCCACCCTCGG - Exonic
1126542750 15:49840599-49840621 CCCAGACCCTGCTCCAAACTGGG + Intergenic
1128838138 15:70827957-70827979 ACCAGTTCCTTCTCCACACTGGG - Intergenic
1129150165 15:73683721-73683743 ACAGGGCCCCGCTCCAGCCTGGG - Intergenic
1129452236 15:75657566-75657588 ACCGAGGCCTGCTGCACCCTTGG + Exonic
1129816714 15:78561759-78561781 ACCAAGCCCAGTCCCACCCTAGG - Intergenic
1129908846 15:79209398-79209420 AGCAGGTCCTGCTCCTCCCCAGG - Intergenic
1130983314 15:88827944-88827966 ACCAGGGCCTGCTCCCACCCTGG + Intronic
1131215093 15:90529861-90529883 GCCCGGCCCCGCCCCACCCTCGG - Intergenic
1131590762 15:93746526-93746548 ACTAGGCAGTGCTCCACCCAGGG + Intergenic
1132092765 15:98959321-98959343 ACCACGCTCTGCTGCTCCCTTGG - Exonic
1132238334 15:100238419-100238441 GCCAGGCCCGGCTCCAGCCCTGG - Intronic
1132520294 16:384155-384177 CCCAGTCCCTGCTCCAGGCTGGG + Intronic
1132620967 16:868186-868208 TCCATGCTCTGCCCCACCCTGGG + Intronic
1132645441 16:997350-997372 AGCAGCCCCTGCTTCTCCCTGGG + Intergenic
1132959524 16:2614170-2614192 TACAGGGCCTGCTCCTCCCTGGG - Intergenic
1132972585 16:2696145-2696167 TACAGGGCCTGCTCCTCCCTGGG - Intronic
1133072158 16:3253938-3253960 ACCACGCCCTGCCCAACCTTTGG + Intronic
1134138782 16:11698429-11698451 GCCAGGCCCCGCTCCACGCCTGG - Intronic
1136499182 16:30661239-30661261 GCCCCTCCCTGCTCCACCCTGGG + Intronic
1136982807 16:35073546-35073568 CCCAGGCCCTGTTCCAAACTGGG - Intergenic
1138556126 16:57772182-57772204 GCCAGGCCCTGCGCTACCCCAGG + Intronic
1139290701 16:65855574-65855596 ACCTGGCCCTGCTCCACACCTGG - Intergenic
1140228226 16:73096037-73096059 TCCAGGCCCCTCTCCACCCTTGG - Intergenic
1140475296 16:75236901-75236923 GGCAGGCCCTTCTCCACACTGGG + Exonic
1140640496 16:76966599-76966621 ACCAGGCCCAGCTCCAACATTGG - Intergenic
1141614514 16:85202798-85202820 GCCAGGCCTGGCTCCACGCTGGG - Intergenic
1141618750 16:85225301-85225323 GCCAGCCCCAGCTCCACCCTGGG - Intergenic
1141677696 16:85526211-85526233 GCCAGGCCCAGCTCCTCCCCAGG + Intergenic
1141982811 16:87560687-87560709 CCCAGGCCTAGCTCCACCCTAGG - Intergenic
1142066860 16:88067760-88067782 ACCTCGCCCTGCTCCACCCCAGG + Intronic
1142112737 16:88340898-88340920 GCGAGGCCCTCCTCCACGCTAGG - Intergenic
1142202721 16:88768751-88768773 GCCAGGCCCTGCTCCCTTCTAGG + Intronic
1142292879 16:89200964-89200986 TCCAGGCCCTGCTCCCCCACCGG + Intronic
1142471845 17:169056-169078 ACCTAGCCCTGCCCCGCCCTGGG + Intronic
1143521308 17:7445718-7445740 ACCAAGCTCCGCCCCACCCTGGG - Intronic
1144090603 17:11852558-11852580 ACCAGGGGCTGCTCCAGGCTGGG - Intronic
1144728247 17:17512440-17512462 ACCTGGCCCTGCACCTCCCTGGG + Intronic
1145028668 17:19488242-19488264 ACCAGGCCCTGCTCAGCCCGAGG - Intergenic
1145128614 17:20321596-20321618 ACCAAGACGTGCTCCACCCCAGG - Intergenic
1145959920 17:28881358-28881380 AAGAGGACCTGCTTCACCCTGGG + Exonic
1146861322 17:36301715-36301737 TCCAGGCCCTGCTCAACACTAGG - Intronic
1146909806 17:36641469-36641491 CCCAGGCCCGGCTCCACTCATGG - Intergenic
1147091654 17:38105819-38105841 TCCAGGCCCTGCTCAACACTAGG - Intergenic
1147105558 17:38214686-38214708 TCCAGGCCCTGCTCAACACTAGG + Intergenic
1147562718 17:41518886-41518908 ACCAGGCCAGGCTGCACGCTGGG + Exonic
1147949100 17:44097151-44097173 AGCAGGCCTTGCTCCTGCCTTGG - Intronic
1148180301 17:45600550-45600572 ACACGGCCCTGCCCCATCCTGGG - Intergenic
1148268599 17:46245344-46245366 ACACGGCCCTGCCCCATCCTGGG + Intergenic
1148423943 17:47573817-47573839 TCCAGGCCCTGCTCAACACTAGG - Intronic
1148848631 17:50543337-50543359 ACCAGGCCTCACCCCACCCTTGG - Exonic
1149581142 17:57751093-57751115 AGCTGGCCCTTCTCCAGCCTGGG + Intergenic
1149884582 17:60327789-60327811 CCCAGCCCCTGCTCCAATCTTGG + Intronic
1150460520 17:65346392-65346414 ACCCAGCCCTGGCCCACCCTGGG - Intergenic
1151270045 17:72986998-72987020 ACCAGGCCCTCCTCCAGCACTGG - Intronic
1151393243 17:73801939-73801961 ACCTGGCCAGGCTCCATCCTTGG + Intergenic
1151766857 17:76137327-76137349 GCCAGGCCCTGCCCCACCTCTGG - Exonic
1151958890 17:77394644-77394666 ACAGAGCCCTGCTCCAGCCTGGG - Intronic
1152027973 17:77824028-77824050 GCCAGGCCCTGCTAGACACTAGG + Intergenic
1152089841 17:78240311-78240333 GCCCAGCCCTGCGCCACCCTAGG - Exonic
1152231282 17:79115284-79115306 TCCAGCCCCTGCTCGACCCCCGG - Intronic
1152267988 17:79307276-79307298 ACACGGTCCTGTTCCACCCTAGG + Intronic
1152594028 17:81229533-81229555 ACCAGGGCCCGCTTCTCCCTAGG + Intronic
1152687962 17:81703799-81703821 ACGATTCCCTGCTCCTCCCTTGG + Intronic
1152689233 17:81710425-81710447 TCCAGGCCCTGCTTCCCCCAAGG + Intergenic
1152755036 17:82083703-82083725 GCCAGACCCTGCTTCTCCCTGGG + Intronic
1153964424 18:10166997-10167019 ATCAGGCCCGGCCCCACCCCTGG + Intergenic
1153987168 18:10362733-10362755 ACCAGGCCCTCCTCCAACACTGG - Intergenic
1154045922 18:10904692-10904714 TCCAGTGCCTGCTCCATCCTGGG - Intronic
1156290896 18:35747913-35747935 CCCAGGCCCAGCTCAAGCCTGGG + Intergenic
1156493096 18:37507993-37508015 ACCAGCCCCTGCCCCAGCCCAGG + Intronic
1156500367 18:37553820-37553842 CCCAGGCCCTGCCTCACCCCAGG - Intronic
1158154915 18:54414837-54414859 ACAAGTCATTGCTCCACCCTGGG + Intergenic
1158941152 18:62406691-62406713 ACCAGCCCCTGCTCAGCTCTTGG + Intergenic
1160064242 18:75560345-75560367 ACCAGTCCCAGTTCCAGCCTTGG - Intergenic
1160827818 19:1088927-1088949 ACCAGGCCAAGCCCCACCCCTGG + Intronic
1160854662 19:1211347-1211369 GCCCTTCCCTGCTCCACCCTAGG - Intronic
1160859962 19:1233577-1233599 CCCAGGCCCTGCTGCAGCCCCGG + Exonic
1160911990 19:1478830-1478852 TCCAGGATCTGCTCCACCGTGGG + Exonic
1160918352 19:1508223-1508245 GCCAGGTCCTGCTCCTCCCTAGG - Intronic
1161102637 19:2428903-2428925 ACCACCCCCAGCTCCACCCAAGG + Exonic
1161152083 19:2714801-2714823 CTCAGGCCCTGCCCGACCCTGGG - Exonic
1161623411 19:5311396-5311418 ACCAGGCCCTGATCCTCACAGGG - Intronic
1161812080 19:6476814-6476836 GCCAGGCCCTGCTCCCACCCCGG + Intronic
1162499259 19:11042115-11042137 GCCAGGCCCTGCTCCAAGCCTGG + Intronic
1162612264 19:11766037-11766059 CCCAGGTTCTGATCCACCCTAGG + Intergenic
1162705591 19:12552526-12552548 ACCAGGTTCTGATCCACACTGGG - Intronic
1162998474 19:14351136-14351158 CCCAGGCCCTGCTACCCTCTAGG - Intergenic
1163834916 19:19567409-19567431 ACCATGCTCTGCTCCAACCCAGG - Intronic
1163851915 19:19669078-19669100 CCCAGGCGCAGCTCGACCCTTGG + Intronic
1164136567 19:22422149-22422171 ACCAGCCCCTTCTCCTCTCTAGG + Intronic
1164921935 19:32094881-32094903 ACCATGACCTGCCCCTCCCTTGG + Intergenic
1165075436 19:33277704-33277726 GTCGGGCCCTCCTCCACCCTGGG + Intergenic
1165336745 19:35175866-35175888 ACCAGGCCCCCCTCCATCATCGG - Intergenic
1165957734 19:39512256-39512278 ACCAGGCCCACCTCCAACATTGG + Intergenic
1166239093 19:41477562-41477584 ACCAGGACCACCTCCACCATTGG - Intergenic
1166680371 19:44762490-44762512 ATCAGGCCCACCTCCAACCTTGG + Intergenic
1166717211 19:44976229-44976251 GCCAGGCCCTGGTCCTTCCTTGG - Intronic
1166813383 19:45527242-45527264 ACCCTGCCCTTCACCACCCTAGG + Intergenic
1166978644 19:46620033-46620055 ACAAGCCCCTGCTCCACCCTGGG - Intergenic
1167148940 19:47698122-47698144 GGCAGGCCCAACTCCACCCTCGG - Intronic
1167462292 19:49632035-49632057 CAAAGGCCATGCTCCACCCTAGG + Intergenic
1167879482 19:52444379-52444401 ACCAGGACCTGCTCCAGTGTAGG + Intronic
1167971859 19:53192829-53192851 GCCGGGCCCTGCTGCTCCCTAGG - Intronic
1168136446 19:54355429-54355451 ACCAGGCACTCCCTCACCCTGGG - Intronic
1168418218 19:56183004-56183026 TCCTCCCCCTGCTCCACCCTCGG + Intronic
925278368 2:2666200-2666222 CCCAGGCACTGCTCCATTCTGGG - Intergenic
925750914 2:7090128-7090150 ACCAGGTCCTCCTCCACGCCCGG - Intergenic
926541098 2:14182546-14182568 CCCAGGCCCAGCTCCACCTTGGG - Intergenic
926838632 2:17052836-17052858 ACCAGGCCGTGCTCAGTCCTTGG + Intergenic
927055007 2:19359127-19359149 GCCAGGAGCTGCTCCACACTCGG - Intergenic
927181018 2:20446922-20446944 AGCTGGCCCTGCCCCGCCCTCGG + Intergenic
927653410 2:24926440-24926462 ACCAAGCCCAGCACCAGCCTGGG - Intergenic
927954444 2:27198909-27198931 ACCAGGCCCTGTTCCTCCACAGG + Intergenic
928022732 2:27716340-27716362 ACCAGGCCCTGCTCCTCTGCTGG + Intergenic
928387878 2:30885026-30885048 ACCAGGCCCTCCATCTCCCTGGG - Intergenic
929517291 2:42615391-42615413 ACTAGGCCCAGATCCAGCCTAGG - Intronic
930841676 2:55854136-55854158 ACCAGGCCCACCTCCAACATTGG + Intergenic
930946792 2:57084904-57084926 CTCAGGCCCAGCTCCACCCCAGG + Intergenic
932390941 2:71390214-71390236 CCCAGGCCCTGCTCCAAACTTGG + Intronic
933093054 2:78145754-78145776 CCCAGGCCCAGCTCCACCTCAGG - Intergenic
934516944 2:94994125-94994147 GCCAGCTCCTGCTCCACCCCAGG - Intergenic
934523854 2:95036417-95036439 ACCAGGCCTGAATCCACCCTTGG + Intronic
934649650 2:96083641-96083663 CCCAGGCCCTGCCCTACCCCAGG + Intergenic
934918022 2:98316675-98316697 ACCAGGCCCTCCTCAAACATTGG - Intergenic
935077255 2:99757042-99757064 TCCTGGCCCAGCTCCACTCTCGG + Intronic
936153654 2:110035118-110035140 CCCAGGGCCTGTGCCACCCTGGG - Intergenic
936191029 2:110336297-110336319 CCCAGGGCCTGTGCCACCCTGGG + Intergenic
936286170 2:111182997-111183019 GCCAGGCCCAGCCCCACTCTTGG + Intergenic
937274091 2:120673160-120673182 GCCAGGCCCTCCTGCTCCCTTGG + Intergenic
937281078 2:120717448-120717470 TCCAGGCCTGGCTCCACCATCGG - Intergenic
937488316 2:122338986-122339008 CCCAGGTCCAGCACCACCCTTGG - Intergenic
937869304 2:126776445-126776467 GCCAGGCACGGCTCCCCCCTGGG + Intergenic
937949365 2:127371925-127371947 CCCAGGCCCTGCTGCAAACTGGG + Intronic
938091618 2:128438206-128438228 ACCAGGCTGCGCTCCACACTGGG - Intergenic
938099578 2:128489685-128489707 ATCAGTCCCAGCCCCACCCTCGG + Intergenic
938166796 2:129036257-129036279 ACCAGGTCCACCTCCAACCTTGG - Intergenic
938288269 2:130136285-130136307 ACCAGGCCCTGGAGCACACTGGG - Intergenic
938427312 2:131202611-131202633 ACCAGGCCCTGGAGCACGCTGGG + Intronic
938729407 2:134134609-134134631 ACCACGCCCTGCCCACCCCTGGG - Intronic
939447891 2:142333907-142333929 ACCAGGCCCATCTCCAACATTGG + Intergenic
941043494 2:160648549-160648571 CCCAGACCCAGCTCCACCTTGGG - Intergenic
941850329 2:170173724-170173746 ACCAGGACCTGCCACACCATAGG + Intergenic
945044891 2:205773163-205773185 ATCTGGCCCTGTTCCAGCCTTGG - Intronic
946415656 2:219538537-219538559 TCCAGGCCCAGCTCCCCTCTTGG + Exonic
947151714 2:227122816-227122838 ACCTGGTCCTGATCCACACTTGG + Intronic
948062865 2:235054402-235054424 CCCAGGTCCTGCTCCCTCCTCGG + Exonic
948212961 2:236208553-236208575 ACCCGGACATGCCCCACCCTGGG + Intronic
948772085 2:240256729-240256751 TCCATGAGCTGCTCCACCCTCGG + Intergenic
948796747 2:240407202-240407224 ACCAGGCCCTTCTCCAACACTGG - Intergenic
1168938551 20:1689241-1689263 ACCAGGCCCACCTCCAACATTGG + Intergenic
1168967249 20:1906265-1906287 GCCAGGCACTGCTCCAACCCTGG + Intronic
1169135458 20:3194633-3194655 CCCAGGTCCTTCTCCACCTTCGG + Intronic
1170605738 20:17874066-17874088 GCAAGGCCCTGCCCCACTCTTGG + Intergenic
1170657062 20:18297913-18297935 AGCAGGCCCTGCTTCACTCATGG + Intronic
1171435280 20:25117404-25117426 ACCCTGCCCTGCTCCCTCCTCGG + Intergenic
1172098370 20:32471673-32471695 ACCAGGCCCACCTCCAACCCTGG - Intronic
1173660058 20:44727136-44727158 CCCAGGCCGTGCTCCATTCTGGG - Exonic
1173939088 20:46894805-46894827 ACCGGCCCCTTCTCCTCCCTGGG - Exonic
1174061088 20:47833599-47833621 AGCAGCACCGGCTCCACCCTGGG - Intergenic
1174070688 20:47897100-47897122 AGCAGCACCGGCTCCACCCTGGG + Intergenic
1174100411 20:48122629-48122651 AGCAGCACCGGCTCCACCCTGGG - Intergenic
1174153371 20:48501556-48501578 AGCAGCACCGGCTCCACCCTGGG - Intergenic
1174176964 20:48651358-48651380 GCCTGGCCCTGCCCTACCCTGGG - Intronic
1174406279 20:50305339-50305361 ACAAGGCCCAGCACCACCCCCGG + Intergenic
1174410298 20:50330760-50330782 GCCTGGCCCTGCTCCAGCCAGGG + Intergenic
1174416333 20:50369681-50369703 CCCTGGCCCTGCTGCACTCTTGG + Intergenic
1174579251 20:51559401-51559423 ACCAGGCTCTGGTCCCACCTCGG + Intronic
1174589650 20:51635032-51635054 ACTAGGCCCAGCTCCACTCCAGG - Intronic
1174858659 20:54069791-54069813 GCCAGCCCCAGCTCCACCCTGGG - Intronic
1175376060 20:58524806-58524828 GCCAGCCCCTGCTGCTCCCTGGG + Intergenic
1175468667 20:59210249-59210271 AGCAGGACATGCTCCACACTTGG + Intronic
1175870728 20:62208307-62208329 ATGAGGCTCTGCTCCACCCTTGG - Intergenic
1175923176 20:62459371-62459393 ACCAGGCCCTTCCCCACTGTGGG + Intergenic
1176180548 20:63747510-63747532 ACCAGGCCCTGCTCACCCCCTGG - Intronic
1176243157 20:64084270-64084292 ACCGGGCCCTGCCCGCCCCTCGG + Exonic
1176268292 20:64222094-64222116 ACCAGGGCCTGTTCCTCCCCAGG - Intronic
1176389960 21:6158345-6158367 AGCTGGCCCTGCTACAGCCTCGG + Intergenic
1176423501 21:6533794-6533816 CCCAGGACCTGCTCAGCCCTGGG + Intergenic
1177081871 21:16649669-16649691 ATCTGTCCCTGCTCCACCTTTGG - Intergenic
1178821255 21:35977195-35977217 TGCAGGCCCTGCATCACCCTCGG + Intronic
1179698995 21:43142110-43142132 CCCAGGACCTGCTCAGCCCTGGG + Intergenic
1179733506 21:43379895-43379917 AGCTGGCCCTGCTACAGCCTCGG - Intergenic
1179934013 21:44591151-44591173 AGCAGGCCTGGTTCCACCCTGGG - Intronic
1179940877 21:44638387-44638409 AGCAGGCCTGGTTCCACCCTGGG + Exonic
1181035215 22:20166694-20166716 CCCAGGTCCTGCCCCAACCTGGG - Intergenic
1181532895 22:23527114-23527136 ACCAGGCCCTGGGCTACCCAAGG + Intergenic
1182371356 22:29813305-29813327 ACCAGTCCCTCTTCCAGCCTGGG - Intronic
1182585264 22:31341281-31341303 AGCATGCCCAGCTCCTCCCTGGG - Intronic
1183530044 22:38348477-38348499 ACCTGACCGTGCCCCACCCTCGG + Intronic
1183633340 22:39046453-39046475 TCCAGACCTTGCTGCACCCTGGG + Intronic
1183697531 22:39431591-39431613 ACCAGGCCCTGCTCTGCCGCAGG - Exonic
1184190901 22:42893693-42893715 ACCAGGCCCTGATGCGCCCCTGG + Intronic
1184273288 22:43396828-43396850 CCCAGGCCCTGCCCCAGCCAAGG - Intergenic
1184470290 22:44692228-44692250 ACCTGGCGCTCCTCCACCCAGGG + Intronic
1184470417 22:44692549-44692571 ACCTGGCACTCCTCCACCCAGGG + Intronic
1184479715 22:44739225-44739247 ACCAGTCCCTGGGCCACCCCAGG - Intronic
1184608754 22:45589515-45589537 ACGTGGCCTTGCTCCAGCCTGGG + Intronic
1185116936 22:48943174-48943196 GCCTGGCTCTGCCCCACCCTCGG + Intergenic
1185384815 22:50526806-50526828 TCCAGCCCCTGCTGCACCCTGGG + Intronic
950118265 3:10465023-10465045 GCCAGGCCCTTCTCCAATCTTGG + Intronic
950707821 3:14793874-14793896 CCCAGGCCCCTCGCCACCCTGGG + Intergenic
952030254 3:29132952-29132974 ACCAGGCCCATCTCCAACATCGG - Intergenic
953018191 3:39097996-39098018 ACCAGACCCTGCTGCCTCCTGGG + Exonic
953033609 3:39193203-39193225 ACCAGGCCCAGCTCTTCACTGGG + Intergenic
954583770 3:51717790-51717812 GCCAGGGCCAGCTCCAGCCTTGG + Exonic
960216424 3:115043845-115043867 ACCAGGCCCTCCTCCAACACCGG - Intronic
960989274 3:123300325-123300347 CCCAGGCCCTGCCCGACCCCGGG + Intronic
960989617 3:123301963-123301985 GCCAAGCCCTGCTCCTCCCTGGG + Intronic
961386766 3:126527194-126527216 CCCAGCCCCTGCTCACCCCTAGG + Intronic
961558169 3:127710855-127710877 GCCTGGCTCTGCTCCACCTTGGG + Intronic
961673802 3:128552811-128552833 ACCCTGCCCTCCTCCATCCTTGG - Intergenic
961870148 3:129981578-129981600 TTCAGGCCATGCTCCACACTGGG + Intergenic
963804986 3:149714116-149714138 CCCAGGCCCAGCTCCGCCTTGGG - Intronic
965781847 3:172294547-172294569 ACCAGGCCCTCCTCCAAGATTGG + Intronic
967840908 3:194003778-194003800 TCCCTGCCCTGCTCCAGCCTCGG - Intergenic
968445792 4:651396-651418 CCCAGGCCCTCCTCCTCCCAAGG - Intronic
968703712 4:2068791-2068813 CCCAGGCCCTGCTCCACTGAGGG - Exonic
968907782 4:3462663-3462685 ACCAGGGCCTGCTCTTGCCTGGG + Intergenic
969305573 4:6324566-6324588 ACCAGGCCCTGCTTCCCTCCAGG + Intronic
969307985 4:6336529-6336551 GCCAGGCCTGGCACCACCCTGGG + Intronic
969427945 4:7136847-7136869 GCCAGGCCCTGCCCCAGGCTGGG - Intergenic
969683614 4:8656815-8656837 CCCAGCCCCTGCTCCTGCCTGGG - Intergenic
972692261 4:41410857-41410879 GCCAGGCCCTGCTCCCTGCTGGG + Intronic
975044196 4:69782813-69782835 CCCAGGCCCAGCTCCGCCTTCGG - Intronic
976609115 4:87011131-87011153 CCCTGGCCCTTCTCCACCCTGGG + Intronic
979428181 4:120593846-120593868 ACCAGCCCCTCCTCCAACATTGG + Intergenic
980526390 4:133995084-133995106 CCCAGGCCCCGCTCCAAACTAGG - Intergenic
980730063 4:136812596-136812618 CCCAAGCCCGGCTCCACCTTGGG + Intergenic
980980696 4:139652299-139652321 ACCAGGCCCTGCCCCTCATTTGG + Intergenic
981460907 4:145012864-145012886 ACCAGGCCCCCCTCCATCATTGG - Intronic
982260498 4:153489995-153490017 ACCAAGACCTGCTTCAGCCTGGG - Intronic
989204893 5:38800557-38800579 ACCAAGACCCACTCCACCCTCGG - Intergenic
989497309 5:42124336-42124358 ACCAGGCCCCCCTCCAACATTGG + Intergenic
992073338 5:73168882-73168904 ACTGGGCCCTGCATCACCCTAGG - Intergenic
992140876 5:73795933-73795955 ACCAGGTGTTCCTCCACCCTTGG + Intronic
996394846 5:123003203-123003225 ACGCAGCCCTGCTCCTCCCTAGG + Intronic
996493856 5:124130514-124130536 TCCAGGCCCTGCCCCACCAAGGG + Intergenic
997259340 5:132454158-132454180 ACCTTGCCCTGCCCCACCCCAGG - Intronic
998165430 5:139839934-139839956 ACCAGGAGCTGCTCCACCAAAGG - Intronic
999141625 5:149366180-149366202 ACCTGCCCCTCCTCCACCCAAGG + Intronic
999142598 5:149372217-149372239 AGCAGCCGCTTCTCCACCCTTGG - Intronic
999270496 5:150294020-150294042 CCCAGGCCCTGCAGGACCCTGGG - Intergenic
999980870 5:156956769-156956791 ACCACACCCTGCTCCCCCTTGGG + Intronic
1001721528 5:173860771-173860793 GCCAGGCCCTGCTGCAGCCAGGG + Intergenic
1002020893 5:176363982-176364004 ACCACGCCCGGCTCCACGCCCGG + Intergenic
1002701339 5:181127423-181127445 ACGAGGACCTGCTCCACACATGG + Intergenic
1005575608 6:27186587-27186609 GCCAGGGCCTGATCCACCCGTGG + Intergenic
1007430753 6:41775390-41775412 ACCAGGCCCTGCTCCACCCTGGG - Intronic
1007475683 6:42118409-42118431 ACCTTACACTGCTCCACCCTTGG + Intronic
1007584254 6:42979041-42979063 ACCAGGCCCAGCTCCGCCGCCGG + Exonic
1007600709 6:43079176-43079198 ACCAGGCCTGGCCGCACCCTTGG - Intronic
1007708462 6:43806059-43806081 TCTAGACCCTGCTCCGCCCTGGG - Intergenic
1008449608 6:51635480-51635502 ACCAGGCTTTTCTACACCCTTGG + Intronic
1008750974 6:54733481-54733503 ACCAGGCCCCTCTCCAACATTGG + Intergenic
1008758772 6:54828709-54828731 ACCAGGCCCATCTCCAACATTGG + Intergenic
1009460944 6:63912632-63912654 ACCAGGCCCCCCTCCAACATTGG - Intronic
1010625769 6:78134989-78135011 CCCAGGCCCTGCTCCAAATTGGG + Intergenic
1012588019 6:100946890-100946912 CCCAGGCCCTGCTTCAAACTGGG + Intergenic
1013188978 6:107785871-107785893 GCCAGGCTCTGCCCCTCCCTTGG - Intronic
1015603457 6:134932969-134932991 ACCAGGGCCTCACCCACCCTGGG + Exonic
1018028197 6:159821908-159821930 GCCCGGCCCTGCTCCACCGCTGG - Intergenic
1018469297 6:164081970-164081992 ACCTGTGCCTGATCCACCCTCGG - Intergenic
1018494256 6:164332389-164332411 ACGAGGCCGTCCTCCTCCCTGGG + Intergenic
1019518507 7:1450134-1450156 CCCAGGCCCTGCACCTGCCTTGG - Intronic
1019634712 7:2069391-2069413 ACCAAGCCCCGCCCCACCCCAGG + Intronic
1019667590 7:2259532-2259554 CCCAGGCCCTGCTGCACCCCAGG + Intronic
1021744600 7:23726089-23726111 ACCAGGCCCCCCTCCAACATTGG + Intronic
1021758707 7:23882102-23882124 ACCAGGCCCACCTCCAACATTGG + Intergenic
1021940896 7:25678227-25678249 ACCAGCCCCACCTCCAGCCTGGG + Intergenic
1022559789 7:31336405-31336427 ACCCTGCCCTGCTCCTCCCACGG - Intergenic
1023383513 7:39632145-39632167 ACTAGGCCCGCCTCCAACCTTGG + Intronic
1025233651 7:57219339-57219361 AGCAGCACCGGCTCCACCCTGGG + Intergenic
1025562026 7:62380850-62380872 CCCAGCCCCTGCGCCACCCTCGG - Intergenic
1025815057 7:64903443-64903465 ACCAGGCCCTCCCCCTCTCTCGG - Intronic
1026138046 7:67680635-67680657 ACCAGGCCCACCTCCAACATTGG + Intergenic
1026979412 7:74517860-74517882 ACCAAGCCCCTCTCCACTCTGGG - Intronic
1027187071 7:75979084-75979106 ACCACGCCCGGCTGCATCCTTGG + Intronic
1029979240 7:104862709-104862731 ACCTGGACCTGCTGAACCCTGGG + Intronic
1032125966 7:129193115-129193137 TCCAGGCCGTGGTCCACCTTAGG + Intronic
1033259557 7:139831121-139831143 ACCAGGGCCTCCTCCAGACTGGG - Intronic
1034100539 7:148446237-148446259 ACCAGGCACTGCTGCAGCATGGG - Intergenic
1034729011 7:153367128-153367150 ACCAGGCCCTGCCACAACATTGG + Intergenic
1034943554 7:155247888-155247910 CCCAGGCCCAGCTCCAATCTGGG + Intergenic
1035172162 7:157022801-157022823 AGCAGCCCCTGGTCCACCCTGGG + Intergenic
1035278062 7:157759845-157759867 ACCAGCCCCTGCCCCTCTCTTGG + Intronic
1035321287 7:158030774-158030796 TCCAGGCCCTGCACCCCCCAGGG - Intronic
1035955691 8:4076727-4076749 TCCAAGCCCTGACCCACCCTGGG + Intronic
1036510078 8:9392034-9392056 ACTAGGCTCAGCTCCACCATTGG - Intergenic
1036672099 8:10797126-10797148 ACCAGGCCCTTCTCCCTCCACGG - Intronic
1036914561 8:12792901-12792923 ACCAGGCCCAACTCCAACATTGG + Intergenic
1036971605 8:13361553-13361575 ACCACGCCCTGCTCCAGTGTAGG + Intronic
1037033905 8:14142693-14142715 ACCAGGCCCATCTCCAGCATTGG - Intronic
1038219054 8:25590234-25590256 ACCATGCCCTGCACAACCCCAGG - Intergenic
1038612714 8:29070211-29070233 ACCAGGCGCTGCACCACCCAGGG + Exonic
1039168713 8:34715954-34715976 ACCAGGCCCACCTCCAACATTGG + Intergenic
1040107566 8:43549215-43549237 AGCAGGCCCTGCCCCAGACTTGG - Intergenic
1040421393 8:47243247-47243269 TCCAGGTCCTTCTCTACCCTGGG + Intergenic
1042194505 8:66220970-66220992 ACCATGCCATGCTCAGCCCTGGG + Intergenic
1043591760 8:81841807-81841829 ACCAGGCACAGTTCGACCCTCGG + Intronic
1043656495 8:82674242-82674264 CCCTGGCCATGCTCCACCCCAGG - Intergenic
1044409318 8:91867227-91867249 CCCAGGCCCAGCTCCACCTTGGG - Intergenic
1045305037 8:100951345-100951367 ACCCGGCCCTCCCCCACCCCGGG - Intronic
1045611536 8:103848438-103848460 ATCTGGACCTGCTCAACCCTAGG + Intronic
1049215425 8:141405656-141405678 ACCGGCCACAGCTCCACCCTCGG - Intronic
1049337168 8:142092592-142092614 GGCAGGCCCTGCTCCAACGTGGG - Intergenic
1049417178 8:142500427-142500449 CCCATGCCCTCCTCCACCTTGGG + Intronic
1049451308 8:142663597-142663619 ACCAGGCCCTGCTCATCACCCGG - Intronic
1049517244 8:143066979-143067001 ACCAGGCCCACCTCCACCACTGG - Intergenic
1049600405 8:143504890-143504912 AGCAGGCCCGGCTCCATGCTCGG + Intronic
1049624782 8:143615100-143615122 GCCAGCCCCTCCTCCAGCCTTGG - Intronic
1049640033 8:143711346-143711368 ACCAGGTCCTGCACCATCCATGG + Intronic
1049742943 8:144249728-144249750 CTCAGGCCCAGCTCCATCCTCGG + Intronic
1049757074 8:144315493-144315515 ACCAGGGCCTGGTCCAGTCTTGG + Exonic
1052974545 9:34401265-34401287 CCCAGGCCCCGCTCCTGCCTAGG + Intronic
1053273272 9:36764927-36764949 TGAAGGCCCTCCTCCACCCTTGG - Intergenic
1053450773 9:38192400-38192422 ACCAGACCCTGCACCACCACAGG + Intergenic
1054952823 9:70872261-70872283 AACTGGCCCTGGTCAACCCTTGG + Intronic
1055096269 9:72417685-72417707 ACCAGGCTGCACTCCACCCTGGG - Intergenic
1056333079 9:85537903-85537925 ACCAGGCCCTGTGCCCCTCTTGG + Intergenic
1056722128 9:89081644-89081666 AGTTGGCCCTGCTCCTCCCTGGG + Intronic
1057046926 9:91893205-91893227 ACCATGCCCAGCTTCAGCCTGGG - Intronic
1057187440 9:93064822-93064844 CCCAGTCACTTCTCCACCCTGGG - Intronic
1058001494 9:99870441-99870463 ACGAGGCCCTGCTCCACTTTTGG + Intergenic
1058303003 9:103399097-103399119 ACCAGGCCCTGCTCATTCCCTGG + Intergenic
1058835368 9:108855113-108855135 ACCAGGCCCAGCTCCTCCTCGGG + Exonic
1058963580 9:110015669-110015691 CCCAGCCTCTTCTCCACCCTGGG + Intronic
1060054169 9:120399638-120399660 ACCAGGTCCTGTTCCATCTTAGG - Intronic
1060105394 9:120869881-120869903 ACCAGCCCCTGCTCACACCTTGG - Exonic
1060547137 9:124468299-124468321 CCCGGGCCCTGCTCCTCCCCAGG - Intronic
1060815566 9:126633335-126633357 ACCAGGCCCTGTGCCAGGCTTGG - Intronic
1060972252 9:127744937-127744959 ACCAGCCCCTCCCACACCCTTGG - Exonic
1060981210 9:127793309-127793331 GCCAGTCCCTGTTCCTCCCTGGG - Intergenic
1061118366 9:128628532-128628554 GCCCAGCCCTGCTCCTCCCTGGG - Intronic
1062044697 9:134419608-134419630 CCCAGGCCCTGCCCCGCGCTGGG - Intronic
1062045152 9:134421585-134421607 ACCAGGCCCTGCCACACGCTGGG - Intronic
1062289909 9:135789821-135789843 GCCAGCCCCTGCCCCACCCCAGG + Intronic
1062486203 9:136777537-136777559 AGCAGCACCAGCTCCACCCTGGG - Intergenic
1062540460 9:137039705-137039727 TCCAGGCCCTGCCCCTCCCCGGG + Exonic
1062629048 9:137455465-137455487 AGCAGGCCCTGCTGCGACCTCGG + Intronic
1062655598 9:137603249-137603271 ACCAGGCCATTCTCCACCCTGGG - Intergenic
1203771356 EBV:51486-51508 ACCAGTCCGTGCCCCACCCTTGG + Intergenic
1185749684 X:2600822-2600844 ACCAGGCCCACCTCCAGCATTGG - Intergenic
1187081881 X:15998682-15998704 ACCAGGCCCACCTCCAACATTGG + Intergenic
1187715179 X:22095552-22095574 ACCAATCCCTCCTCCGCCCTCGG - Intronic
1189157854 X:38777884-38777906 ACTTGGCCCTGCTCCATCCACGG - Intergenic
1189268784 X:39735998-39736020 ACCAGGCCCCGGCCCATCCTTGG - Intergenic
1189366143 X:40390224-40390246 TCCTGCCCCTGCTCCACCATTGG - Intergenic
1189428338 X:40923456-40923478 ACCAGGCCCACCTCCAACATTGG - Intergenic
1192329161 X:70160177-70160199 ACCAGGCCCAGCTTCTCCATGGG + Intronic
1192452552 X:71253093-71253115 CCCTGGCCCTTCTCCATCCTCGG - Exonic
1193467918 X:81869392-81869414 CCCTGGCCCAGCTCCACCTTGGG + Intergenic
1195161902 X:102179593-102179615 CCCAGGCCCTGCTTCAAACTGGG - Intergenic
1195509049 X:105693286-105693308 ACCAGGCCCACCTCCAACATTGG - Intronic
1196217597 X:113072009-113072031 CCCAGGCCGTACTCCACCTTGGG - Intergenic
1199814752 X:151387568-151387590 TCCATCCCCTCCTCCACCCTAGG + Intergenic
1200256764 X:154586438-154586460 ACCAGGCCCGCCGCCACCCGAGG + Intronic
1200261005 X:154617965-154617987 ACCAGGCCCGCCGCCACCCGAGG - Intronic
1200267047 X:154652333-154652355 ACCAGGCCCGCCGCCACCCGAGG - Exonic
1200377375 X:155797467-155797489 ACCAGGCCCACCTCCAACATTGG + Intergenic
1200718210 Y:6574462-6574484 ACCAGGCCCACCTCCAACATTGG - Intergenic
1201758449 Y:17514718-17514740 GCCAGCCCCTGCTCCCTCCTGGG + Intergenic
1201843106 Y:18391272-18391294 GCCAGCCCCTGCTCCCTCCTGGG - Intergenic