ID: 1007430754

View in Genome Browser
Species Human (GRCh38)
Location 6:41775391-41775413
Sequence TACCAGGCCCTGCTCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430754_1007430762 18 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430754_1007430765 30 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430754_1007430763 26 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430754_1007430757 2 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430757 6:41775416-41775438 CACCCTGGCCTGTCTGACATCGG 0: 1
1: 0
2: 0
3: 14
4: 203
1007430754_1007430760 5 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430760 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430754 Original CRISPR TACCAGGCCCTGCTCCACCC TGG (reversed) Intronic
900494242 1:2969262-2969284 CACCAGTGCCTGCTTCACCCTGG + Intergenic
900523322 1:3116543-3116565 GACCAGGCACTGCCCCAGCCGGG - Intronic
900659015 1:3773688-3773710 TCCCATCCCCTGCTGCACCCTGG + Intronic
901041779 1:6368478-6368500 CCCCAGGCCCAGCTCCACCTTGG + Intronic
901127269 1:6938436-6938458 TGCCAGGCTCTGCTCCATGCTGG + Intronic
901195790 1:7439129-7439151 CTCCAGGCCCTGCTGCTCCCAGG + Intronic
901401016 1:9015073-9015095 TCCCAGGCCCTGCCCACCCCGGG - Intronic
901420118 1:9145128-9145150 TACCAAGCCCTGATCCCACCCGG + Intergenic
901917377 1:12510194-12510216 TACCAGGCCTTGCTCCCAGCAGG - Exonic
902058533 1:13622242-13622264 TCCTAGGACCTGCTCAACCCCGG + Intergenic
902691769 1:18114284-18114306 CACTAGACCCTGCTCCACCCAGG + Intronic
903283362 1:22262769-22262791 TACCAGGCCCGGCCCCACCCAGG - Intergenic
903786164 1:25862715-25862737 TACCAGGCCTTGTTCCCACCTGG + Exonic
904038684 1:27572030-27572052 TGCCAGACCCTGCACCAGCCTGG + Intronic
904145803 1:28390499-28390521 CACCATGCCCTGCCCCAGCCTGG - Intronic
904261487 1:29290200-29290222 TACAAGTCCCTTCTCCAGCCAGG + Intronic
904302274 1:29561930-29561952 TACCTGTGCCAGCTCCACCCAGG - Intergenic
904443668 1:30550600-30550622 TCCCAGGCCCAGCTCCGCCTTGG - Intergenic
904480986 1:30793329-30793351 TACCAGGACCCGCTCCAGCCCGG + Intergenic
905336938 1:37251216-37251238 TCCCAAGCCCTGATCCAGCCTGG + Intergenic
907525110 1:55049555-55049577 TAGCAGCCCCTGCCTCACCCGGG + Intronic
907986994 1:59542070-59542092 TACAAGGATCTCCTCCACCCTGG - Intronic
908962511 1:69715216-69715238 TACCAGGCCCTGCCTGACTCTGG + Intronic
911523942 1:98961886-98961908 TACCATCCCCTGCTCCACTAAGG + Intronic
912461513 1:109835351-109835373 TTCCAGGCCCTGTTCCTCCAAGG + Intergenic
912850571 1:113120584-113120606 TACCAGGACCTCCGCCTCCCGGG + Intronic
913486489 1:119336347-119336369 TACCTGGCACGGCACCACCCTGG - Intergenic
913691628 1:121285043-121285065 TACCCTGCCCCCCTCCACCCTGG - Intronic
914145918 1:144994938-144994960 TACCCTGCCCCCCTCCACCCTGG + Intronic
915235024 1:154474158-154474180 TACCAGGTCCATCTCCTCCCGGG - Intronic
915586049 1:156844548-156844570 CACCTGGCCCTGCTGCCCCCTGG - Exonic
916817554 1:168368430-168368452 TCCCAACCCCTGCTCCACACTGG - Intergenic
918003895 1:180524080-180524102 TAACAGTCCCTCCTCCAGCCAGG - Intergenic
919068861 1:192728328-192728350 TTCCAGGCTCTGGTCCACTCTGG + Intergenic
919761578 1:201101531-201101553 CACCCGGCCCTGCCCCAGCCGGG - Intronic
920478956 1:206303521-206303543 TACCCTGCCCCCCTCCACCCTGG - Intronic
920636972 1:207713482-207713504 GTCCAGGCCTTGCTCTACCCAGG + Intronic
922671322 1:227510369-227510391 TCCCAGCCCCTGCTCCCTCCTGG - Intergenic
923324207 1:232866481-232866503 TTCCAGGCCCCTCTCCATCCTGG + Intergenic
924243757 1:242062349-242062371 TCCCAGCCCCTGCTCCCTCCTGG - Intergenic
1065034750 10:21626285-21626307 CACCAGCCCCTGCTCTGCCCTGG - Intronic
1066602831 10:37126010-37126032 TACCAGGCCCTGCCTGAGCCGGG + Intronic
1067318726 10:45198082-45198104 TACCAGGCCCTGCCTGAGCCGGG - Intergenic
1067461671 10:46462746-46462768 TACCCGGCCCTGCTCCTCTCTGG - Intronic
1067625523 10:47921855-47921877 TACCCGGCCCTGCTCCTCTCTGG + Intergenic
1069859783 10:71463254-71463276 TGCCTGTCCCTGCTCCAGCCTGG + Intronic
1069894536 10:71672355-71672377 TGACAGGCCCTGCTGCAGCCCGG + Intronic
1070665038 10:78336720-78336742 TTCCCTGCCCTGCTCCAGCCTGG - Intergenic
1070957169 10:80471795-80471817 GACCAGGCCCTGCCTCACCTAGG + Intronic
1072611111 10:97018304-97018326 CTCCAAGCCCTGCTCAACCCTGG + Intronic
1073267979 10:102239992-102240014 TACCAGTCCCAACACCACCCTGG - Intronic
1074248092 10:111714374-111714396 CTCCAGGCCCAGCTCCACCTTGG + Intergenic
1074870969 10:117575855-117575877 CACCCTGCCCTGCCCCACCCTGG + Intergenic
1074874492 10:117603296-117603318 TCCCAGGCCCTGTTCCCTCCTGG - Intergenic
1075105306 10:119536387-119536409 TCCCAGCCCCTGCCCCGCCCAGG + Intronic
1075715930 10:124555353-124555375 TACAAGGCACAGCTCCTCCCTGG + Intronic
1076403318 10:130197218-130197240 TACCAGGCCATGCTCCTCTGTGG - Intergenic
1076403429 10:130197585-130197607 TACCAGGTGATGCTCCCCCCAGG - Intergenic
1076403443 10:130197635-130197657 TAGCAGGTGCTGCTCCCCCCAGG - Intergenic
1076849116 10:133084345-133084367 TGCCAGGCCCACCTCCACCAAGG + Intronic
1076918676 10:133440235-133440257 CCCCAGGCCATGCACCACCCCGG + Intergenic
1077226832 11:1442250-1442272 TGCCATGCCCTCCTGCACCCTGG - Intronic
1077368992 11:2172828-2172850 TCCCAGCCGCTGCCCCACCCAGG + Intergenic
1077374694 11:2200012-2200034 TCCCAGCCCATCCTCCACCCTGG + Intergenic
1077470828 11:2759809-2759831 GGCCAGCCCCTCCTCCACCCTGG + Intronic
1078194298 11:9122059-9122081 TATCAGGCCCTGCTTCCCCTAGG - Intronic
1081784027 11:45733730-45733752 TCCCAGGCCCTGCATGACCCTGG + Intergenic
1081907346 11:46678348-46678370 TACCAGTCCCTGCACAACCAAGG + Exonic
1082009080 11:47438246-47438268 TCCCAGCCCCTGCTCTGCCCTGG - Intronic
1082821220 11:57545967-57545989 TATCAGCCCCTGCTCGGCCCCGG + Exonic
1083235987 11:61350946-61350968 GACCTGGCCCTGTCCCACCCTGG + Intronic
1083304376 11:61754920-61754942 CACCAGGCCCTGCCACTCCCAGG - Intronic
1083632711 11:64104023-64104045 TACCAGGCCTTGCACCACTAGGG - Exonic
1083654562 11:64223249-64223271 GAGCAGCCCCTGCCCCACCCTGG - Intronic
1083687579 11:64385828-64385850 TGCCAGGCCCTGTGCCACACAGG + Intergenic
1083998085 11:66282105-66282127 GACCAGGCCCTGCTCCTCCCTGG + Intronic
1084212070 11:67628967-67628989 TGCCAGGCCCAGCTCCTCCCGGG + Exonic
1084568386 11:69944436-69944458 TTCCAGCCCCTTCTGCACCCCGG - Intergenic
1084887917 11:72223065-72223087 TCCCAGGCTCTGCTCCAGCTGGG + Intergenic
1085324858 11:75598786-75598808 TACCAGACCGTGCTCCCCCAGGG - Intronic
1085773385 11:79344110-79344132 TACCAGGCACTGTCCCACCTAGG - Intronic
1086450018 11:86906422-86906444 TGCCCGCCCCTGCGCCACCCCGG + Intronic
1087479247 11:98679123-98679145 TACCACGCCCGGCTCCAGGCTGG + Intergenic
1087958917 11:104324012-104324034 AAACAGGCCCTGCTCCAACTTGG + Intergenic
1089207307 11:116774792-116774814 TACACAGCCCTGCCCCACCCTGG + Intergenic
1089348743 11:117809238-117809260 TCCCAGGACCTGCCCCACCCTGG - Intronic
1089362180 11:117898210-117898232 GAGGAGGCCCTCCTCCACCCCGG - Intergenic
1091397745 12:163966-163988 GCCTAGGCCCTGCTCCTCCCAGG - Intronic
1094813326 12:34162693-34162715 TCCCAGCCCCTGCTCCCTCCTGG + Intergenic
1095103588 12:38205832-38205854 TCCCAGCCCCTGCTCCCTCCTGG - Intergenic
1096255884 12:50062187-50062209 TGCCAGGCCCTTCTCCACCGGGG - Intronic
1096467292 12:51853788-51853810 TACCATGACCTGCTCCACCAGGG + Intergenic
1096496413 12:52041828-52041850 GGCCAGGCCCTGCCCCTCCCAGG + Exonic
1097174698 12:57135951-57135973 GTCCATGCCCTGCTCCTCCCAGG - Intronic
1097784965 12:63748723-63748745 TATCAGCCCTTGCTCCACCCAGG - Intergenic
1101383783 12:104237557-104237579 TACCCGGCCCTGTTCCTCCAAGG + Intronic
1101587917 12:106101156-106101178 TACCTGCCCCTGCTGCAACCTGG - Intronic
1102151011 12:110689162-110689184 TACCAGGCCCCGCCCCCGCCCGG + Intronic
1102167663 12:110819635-110819657 GCCCAGGGCCTGCTTCACCCAGG + Intergenic
1102675721 12:114657202-114657224 TACCAGGCCTTGTTCAACCGGGG + Intergenic
1103026873 12:117580973-117580995 TCTCTGGCTCTGCTCCACCCCGG - Intronic
1103927059 12:124429079-124429101 AAACCGGCCCTGCTCCAGCCAGG + Intronic
1104055388 12:125226271-125226293 TTCCAGCCCCAGCTCCACCTTGG + Intronic
1104409998 12:128550006-128550028 TGGCAGACACTGCTCCACCCTGG + Intronic
1104585889 12:130047692-130047714 GAGCAGGTCCTGCTGCACCCAGG + Intergenic
1104923294 12:132302560-132302582 CACCTGGACCTGCCCCACCCAGG - Intronic
1104953165 12:132451447-132451469 TGCCAGCCCCTGCCCCGCCCTGG - Intergenic
1104981950 12:132577161-132577183 CCCCAGGCCCAGGTCCACCCTGG - Intronic
1105223836 13:18409072-18409094 TACCAGGCCCTGCCTGAGCCGGG + Intergenic
1106383885 13:29265839-29265861 CACCAGGCCCACCTCCACACTGG + Intronic
1106867120 13:33977407-33977429 TAAAAAGCACTGCTCCACCCTGG + Intergenic
1111174179 13:84571747-84571769 CACAAGGCCCTGCTCCCCCTTGG + Intergenic
1111976138 13:94968448-94968470 TGCCAGGCCCTGCAACTCCCGGG + Intergenic
1113518393 13:110920355-110920377 TACCAGGGCCCGGTCCAGCCAGG - Intergenic
1113948576 13:114058661-114058683 TCCCAGGCCCTGCTCCTCGGAGG + Intronic
1114069572 14:19096823-19096845 TCCCAGTCCCTACTCAACCCTGG - Intergenic
1117817689 14:59614303-59614325 TTCCTGGCCCTGCTCCTCCAAGG + Intronic
1119323894 14:73747213-73747235 CTCCAGGCCCTGCTGCTCCCAGG - Intronic
1121600638 14:95200455-95200477 GCCCAGGCCCTTCTCCTCCCTGG + Intronic
1121968336 14:98331318-98331340 TTGCTGGCTCTGCTCCACCCAGG - Intergenic
1122275071 14:100587067-100587089 GACCCGGCCCGGCTCCTCCCGGG + Intronic
1124126831 15:26944441-26944463 TGCCAGGCCTTCCTCCAACCTGG - Intronic
1125751742 15:42033797-42033819 CACCAGGGCCCACTCCACCCAGG - Intronic
1128225393 15:65997988-65998010 TACCAAGCCTTTCCCCACCCCGG - Intronic
1128640638 15:69333760-69333782 TTCCCGGCCCTGCTCCTCCAAGG + Intronic
1129150166 15:73683722-73683744 TACAGGGCCCCGCTCCAGCCTGG - Intergenic
1129328234 15:74813130-74813152 TCCCAGGCCTTGCCCCACCCTGG - Intronic
1131231765 15:90665205-90665227 TACCCGGCCCTGTCCCACTCCGG - Intergenic
1131590761 15:93746525-93746547 AACTAGGCAGTGCTCCACCCAGG + Intergenic
1132344823 15:101101743-101101765 TCCAAGTCTCTGCTCCACCCAGG - Intergenic
1132554023 16:564838-564860 TCCCAGGCGCTGCTCCACCCTGG - Exonic
1132686240 16:1163301-1163323 TCCCAGGCCCTGCTCCAACTGGG - Intronic
1132710210 16:1263045-1263067 TTCCAGGCCCTGCTCGACGAGGG + Intergenic
1132752765 16:1466345-1466367 TTCCAGGCCCTGCTGAAACCTGG - Intronic
1132792357 16:1698824-1698846 CACCTGGCTCTGCTCCAGCCGGG - Exonic
1133126881 16:3652902-3652924 TTCCAGGCCCTCCTCCCCCAGGG + Intronic
1133609623 16:7421123-7421145 TACCAGTGCCTTCTCCACCTTGG - Intronic
1135303620 16:21350847-21350869 AACCAGGCCCTGCCCCTTCCTGG - Intergenic
1136300366 16:29330042-29330064 AACCAGGCCCTGCCCCTTCCTGG - Intergenic
1136375179 16:29861172-29861194 AACCTGGCCCTGCTGTACCCTGG - Exonic
1136982809 16:35073547-35073569 TCCCAGGCCCTGTTCCAAACTGG - Intergenic
1138477988 16:57283532-57283554 TATCAGGCCCTCACCCACCCAGG + Intronic
1140475295 16:75236900-75236922 TGGCAGGCCCTTCTCCACACTGG + Exonic
1140487446 16:75304849-75304871 TGACAGGCCCTGCCCCACACTGG + Intronic
1141205685 16:81931670-81931692 TGCCAGGCCCACCTGCACCCGGG - Intronic
1141400415 16:83742250-83742272 TACTGGGGCCTGCGCCACCCTGG - Intronic
1141618751 16:85225302-85225324 GGCCAGCCCCAGCTCCACCCTGG - Intergenic
1142135568 16:88450485-88450507 TTCCAGGCCCTGCTCTCCCTGGG + Intergenic
1142167682 16:88601451-88601473 TTCCGGTCCCTGCTCCAGCCAGG - Intronic
1142237081 16:88927443-88927465 CCCCAGCCCCTCCTCCACCCCGG - Intronic
1142303079 16:89270238-89270260 TATCAGGCTCAGCACCACCCAGG - Intronic
1142752530 17:1997712-1997734 TAGCTGCCCCTGCCCCACCCAGG + Intronic
1144703558 17:17353408-17353430 CCCCAGGCCCTGCTTTACCCAGG - Intergenic
1144728246 17:17512439-17512461 CACCTGGCCCTGCACCTCCCTGG + Intronic
1145018414 17:19413198-19413220 TACCAGACCCAGCTTCCCCCAGG - Intronic
1147182327 17:38694159-38694181 TACCAAAGCCTGCTGCACCCTGG + Intergenic
1147562717 17:41518885-41518907 TACCAGGCCAGGCTGCACGCTGG + Exonic
1147602942 17:41757114-41757136 TACAGGGCACTGCCCCACCCTGG + Intronic
1147769505 17:42857632-42857654 GGCCAGGCCCTGCCCCACCCAGG - Exonic
1148124229 17:45228735-45228757 TCCCAGGCCCTCACCCACCCAGG - Intronic
1148615253 17:48996446-48996468 TTCCAGAGCCTGCACCACCCGGG - Intergenic
1149555628 17:57571430-57571452 CACCAGGCCCCGCTCCTCCCAGG + Intronic
1150390516 17:64787420-64787442 TCCTAGGCCCTGCCCCGCCCAGG - Intergenic
1150485053 17:65537585-65537607 TACCACTCCCTGCTCCCGCCCGG - Exonic
1151228074 17:72661461-72661483 TGACAAGCCCTGCTTCACCCCGG + Intronic
1151485601 17:74397411-74397433 CACCAGGCCCGGCTGCATCCAGG + Intergenic
1152063742 17:78098476-78098498 TCCCAAGCCCTCCTCCACCTGGG + Exonic
1152509186 17:80773706-80773728 CACCAGGCCCTCCTCCAGGCAGG + Intronic
1152847437 17:82610626-82610648 CACCATGCCCAGCTCCGCCCAGG + Intronic
1153949919 18:10049725-10049747 TGCCAGGCCCTCCCCCACCGAGG + Intergenic
1154338782 18:13486491-13486513 CACCAGGGCCTGCTCCACCAGGG + Intronic
1154379593 18:13837403-13837425 TCCCTGGCCCCGCTCCTCCCAGG + Intergenic
1154475263 18:14748642-14748664 TACCAGGCCCTGCCTGAGCCGGG + Intronic
1154499275 18:14987065-14987087 TGCCAGGCCCTGTTCCAGGCAGG + Intergenic
1154529469 18:15330042-15330064 TACCAGGCCCTGCCTGAGCCGGG - Intergenic
1155342155 18:24823664-24823686 CAACAGGCCCTGTTCCACCTTGG - Intergenic
1157244209 18:46039316-46039338 TACCATGCCCTGCCACCCCCAGG + Intronic
1157594378 18:48855031-48855053 GACCAGGCCCTGCTCCAGGGCGG - Intronic
1160134518 18:76261233-76261255 TGCCAGGCCCTGAGCCTCCCGGG + Intergenic
1160681152 19:412176-412198 TCCCTGCCCCTGCCCCACCCAGG - Intergenic
1160723939 19:609265-609287 TGCCAGGCCCTGCTGTCCCCAGG - Intronic
1160769389 19:823515-823537 TAACAGGCACTGCTGCCCCCGGG + Intergenic
1161623412 19:5311397-5311419 TACCAGGCCCTGATCCTCACAGG - Intronic
1163270497 19:16250423-16250445 CACCAGAGCCTGCTCGACCCTGG + Intergenic
1163332955 19:16653029-16653051 TGCCAGATCCTGCTCCACCTGGG - Intronic
1163499075 19:17664796-17664818 TCCCAAGCCCTCCTCAACCCCGG + Intronic
1164683368 19:30150633-30150655 TCCCTGTCCCTGCTCCTCCCCGG + Intergenic
1165071131 19:33255386-33255408 TGCCAAGCCCTGCCCCACTCTGG - Intergenic
1165242575 19:34480612-34480634 TTCCAGCCCCTGCCCCACCAGGG - Intergenic
1166219908 19:41357664-41357686 TCCCACCTCCTGCTCCACCCTGG + Intronic
1166978645 19:46620034-46620056 GACAAGCCCCTGCTCCACCCTGG - Intergenic
1167261789 19:48462909-48462931 TTCCAGGGCCTGCTTCTCCCGGG - Intronic
1167426512 19:49432460-49432482 AATCCGGCTCTGCTCCACCCAGG + Intronic
1168343035 19:55636606-55636628 TCCAAGGCCCAGCTCCATCCTGG - Intronic
925148157 2:1594788-1594810 CACCAGGCTCTGCTGCCCCCTGG + Intergenic
925151547 2:1618689-1618711 AACCAGGCCCTGGTCCTCCAAGG - Intergenic
925278370 2:2666201-2666223 TCCCAGGCACTGCTCCATTCTGG - Intergenic
925635843 2:5940994-5941016 TACCTGGCTCTGCTTAACCCAGG - Intergenic
925855141 2:8122294-8122316 GCCCAGGCACTGCTCCAACCCGG + Intergenic
925919259 2:8627974-8627996 AAGCAGGACCTGCCCCACCCTGG + Intergenic
926228855 2:10987682-10987704 GACCAGCCCCTGCTCACCCCAGG + Intergenic
926541100 2:14182547-14182569 ACCCAGGCCCAGCTCCACCTTGG - Intergenic
927695327 2:25235922-25235944 TGACAGGGCCTGGTCCACCCAGG + Intronic
928394201 2:30931560-30931582 TCTCAGGCCCTGCCCCAGCCTGG + Intronic
928451572 2:31382861-31382883 TAACAAGCACTGCTCCTCCCAGG + Intronic
931828460 2:66026024-66026046 TCCCAGGCACTCCTCCATCCCGG - Intergenic
932276692 2:70457061-70457083 TACCTGGCCCACCTCCACCCAGG + Intronic
933750744 2:85601040-85601062 TCCCAAGACCTGCTGCACCCTGG - Exonic
935832069 2:107010700-107010722 TGCCCAGCCCTGCTCCAGCCAGG - Intergenic
935941324 2:108242393-108242415 TACCTGACCCTGCTCCTCCAAGG - Intergenic
937080446 2:119136471-119136493 TCCCAGGCCCTCCTCCTTCCAGG + Intergenic
937287339 2:120761762-120761784 TGCCAGGCCCTTCTCTCCCCAGG + Intronic
938068279 2:128293313-128293335 TCCCAGGCCTTGCTCTGCCCAGG - Intronic
938528567 2:132161464-132161486 TACCAGGCCCTGCCTGAGCCGGG - Intronic
938729408 2:134134610-134134632 TACCACGCCCTGCCCACCCCTGG - Intronic
944210507 2:197202031-197202053 TAGCTGCCCCTCCTCCACCCAGG + Intronic
945936088 2:215904148-215904170 TACCATAACCTGCTCCTCCCTGG - Intergenic
947523480 2:230865253-230865275 TTCCCAACCCTGCTCCACCCCGG - Intronic
1168853096 20:989936-989958 TGCCAGGACCTGTGCCACCCAGG + Intronic
1169084712 20:2819537-2819559 TCTCAGGCCCTGCTCCAGACAGG + Intronic
1170683054 20:18543958-18543980 TGCCAGGTCCTGCTGCACCGTGG - Intronic
1171361020 20:24586390-24586412 CACCAGGCCCTGCCAGACCCAGG - Intronic
1171784407 20:29449125-29449147 AGCCAGGCCCTGCCCCAGCCAGG - Intergenic
1172446309 20:34995291-34995313 TACCTGGCCCTCCCCCAACCTGG + Intronic
1173708590 20:45135316-45135338 TTCCAGGCCCAACCCCACCCAGG - Intergenic
1174176965 20:48651359-48651381 TGCCTGGCCCTGCCCTACCCTGG - Intronic
1174410297 20:50330759-50330781 TGCCTGGCCCTGCTCCAGCCAGG + Intergenic
1174858660 20:54069792-54069814 TGCCAGCCCCAGCTCCACCCTGG - Intronic
1175134022 20:56809571-56809593 ATCCAGGCCCTGCTCCTCACTGG - Intergenic
1175412131 20:58777344-58777366 AACATGGCCCTGCTCCATCCTGG - Intergenic
1176098938 20:63356283-63356305 GTCCTGGCCCTGCCCCACCCTGG - Intronic
1176767929 21:13038426-13038448 TACCAGGCCCTGCCTGAGCCGGG + Intergenic
1178277518 21:31252333-31252355 GACCAGGTCCTGCTCAACCCTGG + Intronic
1178707934 21:34889861-34889883 TGCCGGGCCCTGCACCTCCCGGG + Intronic
1178978427 21:37240771-37240793 GACCTGGGCCTTCTCCACCCTGG - Intronic
1179114772 21:38480149-38480171 CATCCTGCCCTGCTCCACCCAGG - Intronic
1179721156 21:43316620-43316642 TGCAAGGACGTGCTCCACCCAGG + Intergenic
1182371357 22:29813306-29813328 TACCAGTCCCTCTTCCAGCCTGG - Intronic
1182419592 22:30242446-30242468 GACCAGGCCCTGCTAAGCCCTGG + Exonic
1182519941 22:30879532-30879554 TTCCAGGGCCTGCTCCTCACAGG - Intronic
1183706278 22:39476606-39476628 TACCAGGCCCTCCCTCGCCCAGG + Intronic
1184047276 22:41979275-41979297 CACCATGGCCTGCTCCGCCCTGG - Intronic
1184362474 22:44026623-44026645 GGCCAGGGGCTGCTCCACCCTGG - Intronic
1184370690 22:44080135-44080157 TACTGAGCCCTGCTCCACACCGG - Intronic
1184470289 22:44692227-44692249 CACCTGGCGCTCCTCCACCCAGG + Intronic
1184470416 22:44692548-44692570 CACCTGGCACTCCTCCACCCAGG + Intronic
1184820662 22:46907388-46907410 TACCAGGCAATGCTGCAGCCTGG - Intronic
1185269225 22:49921120-49921142 TGGCAGGCCCTGCTGCTCCCAGG + Intronic
1185270665 22:49928144-49928166 TCCCAGGCCGTGCACCATCCTGG + Intergenic
1185384814 22:50526805-50526827 CTCCAGCCCCTGCTGCACCCTGG + Intronic
950365429 3:12480250-12480272 GGCCAGGCCCAGCTCCTCCCTGG + Intergenic
950373883 3:12554270-12554292 CACCAAGTCCTGCCCCACCCGGG - Intronic
950418019 3:12879685-12879707 TTCCAGGCCCTGCTCCACTGGGG + Intergenic
950639959 3:14342426-14342448 GAGCAGGCCTTGCTCCACACTGG - Intergenic
950707819 3:14793873-14793895 TCCCAGGCCCCTCGCCACCCTGG + Intergenic
950852616 3:16077164-16077186 TCCAAGTCCCTGCTCGACCCAGG - Intergenic
950892690 3:16418531-16418553 TACTAGGCACTTCTCCAGCCAGG + Intronic
952903971 3:38127652-38127674 TTCCAGGCCTTGTGCCACCCAGG - Intronic
954517338 3:51190508-51190530 TACCATTGCCTGCACCACCCCGG - Intronic
954575154 3:51671710-51671732 TTCCAGCCCCTGCTCACCCCGGG - Exonic
954704379 3:52471412-52471434 TTCCAGGCTCTGCACCACGCTGG + Intronic
958135510 3:89484693-89484715 TAGCAGGCCATGCTCTACCTTGG + Intergenic
960053594 3:113260537-113260559 TAACAGGCCATGCACCACCATGG - Intronic
960652173 3:119962993-119963015 TAACAGGCCATGCACCACACTGG + Intronic
960989272 3:123300324-123300346 CCCCAGGCCCTGCCCGACCCCGG + Intronic
960989616 3:123301962-123301984 GGCCAAGCCCTGCTCCTCCCTGG + Intronic
962530776 3:136277865-136277887 TTTCAGGCCATGCTCCTCCCAGG + Intronic
967884339 3:194322906-194322928 CACCTTGCCCTGCCCCACCCAGG - Intergenic
967917252 3:194587901-194587923 TACCAGGACTTCCTCCAACCTGG - Exonic
968678730 4:1901184-1901206 GACAAGGCCCTGCTCCAGCAAGG - Exonic
968703714 4:2068792-2068814 ACCCAGGCCCTGCTCCACTGAGG - Exonic
969052357 4:4382285-4382307 TACCAGGCCATGCTCTAGACAGG + Intronic
969427946 4:7136848-7136870 TGCCAGGCCCTGCCCCAGGCTGG - Intergenic
972692260 4:41410856-41410878 TGCCAGGCCCTGCTCCCTGCTGG + Intronic
975350801 4:73343708-73343730 CACCACACCCTTCTCCACCCTGG - Intergenic
975936616 4:79589063-79589085 TCCCAGTCCCTGCTCAAGCCAGG - Intergenic
976609113 4:87011130-87011152 CCCCTGGCCCTTCTCCACCCTGG + Intronic
977666778 4:99652606-99652628 GAGGAGGCTCTGCTCCACCCTGG + Exonic
984700106 4:182813783-182813805 CACCCGGCCCTGGCCCACCCTGG - Intergenic
984710336 4:182879330-182879352 TACCATGCCCTGGTCTGCCCTGG + Intergenic
984908247 4:184649301-184649323 TCCCAGGCCCTGCGCCCGCCCGG - Intronic
987452292 5:18101066-18101088 TACCAGGCCCTGCTTAAACAGGG - Intergenic
987929530 5:24387067-24387089 TACAAGTCCCTACTCGACCCAGG - Intergenic
990537025 5:56733066-56733088 TTCCAGGCCCAGCTCCAGTCCGG + Intergenic
992663707 5:78985323-78985345 TGCCGGGGCCTGCTCCGCCCCGG + Exonic
996476467 5:123928219-123928241 TACCTGGCCCTGTTCCTCCAAGG - Intergenic
996493855 5:124130513-124130535 TTCCAGGCCCTGCCCCACCAAGG + Intergenic
998463653 5:142326308-142326330 CAGCAGGCCCTGCTCCTCCCTGG + Intronic
999208556 5:149868092-149868114 TACCTGGCTCTGCACCTCCCAGG + Exonic
1001279951 5:170379535-170379557 TGACAGGCCCTGCCACACCCTGG - Intronic
1001721527 5:173860770-173860792 AGCCAGGCCCTGCTGCAGCCAGG + Intergenic
1003654945 6:7998481-7998503 TGCCTGGCCCTCCTCCACCCAGG + Intronic
1004787537 6:18985782-18985804 TTCCAGGCTCTGCTTCACACTGG - Intergenic
1006163833 6:32053213-32053235 CACAGGGCCCTTCTCCACCCAGG + Intronic
1007234113 6:40378238-40378260 TCAGAGGCCCTGCCCCACCCAGG - Intergenic
1007430754 6:41775391-41775413 TACCAGGCCCTGCTCCACCCTGG - Intronic
1007708463 6:43806060-43806082 TTCTAGACCCTGCTCCGCCCTGG - Intergenic
1007936368 6:45736248-45736270 TACCAGGGCCTGCTAGACCACGG - Intergenic
1011029039 6:82901300-82901322 TCCCAAGCCCTGCTCCTCTCTGG - Intronic
1012201122 6:96407020-96407042 TTCCTGGCCCTGCTCCTCCAAGG + Intergenic
1013790864 6:113834976-113834998 TACCAGGCCCCGCACTGCCCTGG - Intergenic
1014271504 6:119341416-119341438 AACCAGGCCCCACTCCACCTGGG - Intronic
1017027912 6:150197676-150197698 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017027928 6:150197724-150197746 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017027944 6:150197772-150197794 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017027988 6:150197916-150197938 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017028033 6:150198060-150198082 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017028079 6:150198204-150198226 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017028094 6:150198252-150198274 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1017028110 6:150198300-150198322 ATCCAGGCCCTCCTCCACCATGG - Intronic
1017028126 6:150198348-150198370 ATCCAGGCCCTCCTCCACCGTGG - Intronic
1018070660 6:160161634-160161656 TTCCAGGGTCTCCTCCACCCTGG + Intergenic
1018370678 6:163165319-163165341 TACCAGCCCCTGCCCCACGCTGG - Intronic
1018726075 6:166614444-166614466 GACCAGGCCCTGCCCTGCCCTGG + Intronic
1018812188 6:167306328-167306350 GACCCTGCCCTGCCCCACCCTGG - Intronic
1022171085 7:27832448-27832470 TGCCAGCCCCTCCTCCCCCCAGG + Exonic
1023872259 7:44269508-44269530 TCCCAGCCCCTCCTCCTCCCTGG + Intronic
1023986817 7:45101790-45101812 TGCCAGGCCCTGTGCCAACCAGG + Intronic
1027586481 7:80064942-80064964 TACCAAGACCTCCTCCTCCCAGG - Intergenic
1030287012 7:107837326-107837348 CACCAAGCTCTGCCCCACCCTGG - Intergenic
1032089459 7:128904012-128904034 GCCCAGGCCCTGCACCTCCCTGG - Intronic
1033259558 7:139831122-139831144 TACCAGGGCCTCCTCCAGACTGG - Intronic
1034943552 7:155247887-155247909 TCCCAGGCCCAGCTCCAATCTGG + Intergenic
1035172161 7:157022800-157022822 CAGCAGCCCCTGGTCCACCCTGG + Intergenic
1035321288 7:158030775-158030797 CTCCAGGCCCTGCACCCCCCAGG - Intronic
1035680138 8:1481944-1481966 TACCTGGCCCTTCTCCACGGGGG - Intergenic
1035704378 8:1664064-1664086 TACCAAACCCTCCTCCACCAGGG + Intronic
1036609788 8:10339921-10339943 TCTCAGGCCCTACCCCACCCAGG + Intronic
1036689939 8:10939056-10939078 TCCCAGGACCTGCTTCTCCCAGG + Intronic
1036766108 8:11550287-11550309 TTCCTTGCCCTGCTCCTCCCGGG + Intronic
1038612713 8:29070210-29070232 CACCAGGCGCTGCACCACCCAGG + Exonic
1044409320 8:91867228-91867250 CCCCAGGCCCAGCTCCACCTTGG - Intergenic
1045305038 8:100951346-100951368 GACCCGGCCCTCCCCCACCCCGG - Intronic
1045472994 8:102529028-102529050 CCCCAGGCCCCGCCCCACCCCGG + Intronic
1047910961 8:129528548-129528570 CATCAGGCCCTGCCCAACCCTGG + Intergenic
1049564864 8:143332742-143332764 CACCACGCCCGGCTCCACCCTGG - Intronic
1049576007 8:143389912-143389934 CACCAGGCCCTCTGCCACCCCGG - Intergenic
1049672677 8:143876863-143876885 TCGCTGGCCCTGCCCCACCCTGG - Intronic
1049726432 8:144148481-144148503 TCCCCGGCCCTTCTCCCCCCAGG + Intronic
1049735099 8:144200585-144200607 TGCCAGGACCTGCTCCATCCTGG - Intronic
1049789348 8:144465824-144465846 GCCCAGGCCCCGCCCCACCCAGG - Intergenic
1051143969 9:14007404-14007426 GACCACGCCCTCCTCTACCCGGG - Intergenic
1051837991 9:21362450-21362472 TCCCAGGCCCACCTCCACCCAGG - Intergenic
1051845735 9:21449343-21449365 TCCCAGGCCCACCTCCACCCAGG + Intergenic
1056838813 9:89981149-89981171 TTCCAGGAGCTGCTCCTCCCTGG - Intergenic
1057125333 9:92611793-92611815 CACCAGCCCCGGCGCCACCCTGG + Intronic
1058835367 9:108855112-108855134 GACCAGGCCCAGCTCCTCCTCGG + Exonic
1058963578 9:110015668-110015690 TCCCAGCCTCTTCTCCACCCTGG + Intronic
1060041722 9:120306266-120306288 GACCACACACTGCTCCACCCTGG - Intergenic
1060929499 9:127479846-127479868 ACTCAGGCCCTGCTCCAGCCGGG - Exonic
1061969482 9:134036183-134036205 TACCCGGCCCAGCTTCTCCCCGG + Exonic
1062045153 9:134421586-134421608 GACCAGGCCCTGCCACACGCTGG - Intronic
1062210344 9:135360245-135360267 TCCCAGGCCCTACTCCACAAAGG + Intergenic
1062359511 9:136180882-136180904 TCCCAGGCCCCTCTCCGCCCAGG - Intergenic
1062540459 9:137039704-137039726 CTCCAGGCCCTGCCCCTCCCCGG + Exonic
1062655599 9:137603250-137603272 TACCAGGCCATTCTCCACCCTGG - Intergenic
1062670808 9:137707854-137707876 TGCCCTGCCATGCTCCACCCCGG + Intronic
1186386003 X:9110742-9110764 TACCAGTCCCTGCATCAACCTGG + Intronic
1191617322 X:63183007-63183029 TTCCTGGCCCTGCTCCTCCAAGG + Intergenic
1191618976 X:63195916-63195938 TTCCTGGCCCTGCTCCTCCAAGG - Intergenic
1195940344 X:110162438-110162460 ACCCAGGCCATGCTTCACCCTGG - Intronic
1196780073 X:119375883-119375905 TACCAGGCCCAGCGCATCCCTGG - Intergenic
1200115986 X:153769920-153769942 TACCTGGCCCTGCTCCTGGCGGG - Exonic
1200838913 Y:7760434-7760456 TACTAGGCACTTCTCCAACCAGG + Intergenic
1201758448 Y:17514717-17514739 TGCCAGCCCCTGCTCCCTCCTGG + Intergenic
1201843107 Y:18391273-18391295 TGCCAGCCCCTGCTCCCTCCTGG - Intergenic