ID: 1007430756

View in Genome Browser
Species Human (GRCh38)
Location 6:41775407-41775429
Sequence GACAGGCCAGGGTGAGTACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430756_1007430765 14 Left 1007430756 6:41775407-41775429 CCTGGTACTCACCCTGGCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430756_1007430763 10 Left 1007430756 6:41775407-41775429 CCTGGTACTCACCCTGGCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430756_1007430762 2 Left 1007430756 6:41775407-41775429 CCTGGTACTCACCCTGGCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430756 Original CRISPR GACAGGCCAGGGTGAGTACC AGG (reversed) Exonic
904819990 1:33235777-33235799 GACAGGCCAGGGTGGGCATAGGG + Intergenic
905277090 1:36825371-36825393 CACAGACGAGGGTGAGGACCAGG + Intronic
905761174 1:40559193-40559215 GGCAGGCCAGCGCGAGTTCCGGG - Intergenic
907054524 1:51352820-51352842 GACAGACCAGGTTCAGTTCCTGG + Intergenic
907328201 1:53654463-53654485 GACAGGCAAGTCTGAGTTCCGGG + Intronic
907447452 1:54517986-54518008 GAGCGGCCAGTGTAAGTACCTGG + Intergenic
908248022 1:62243205-62243227 GCCAGGCCAGGCTGAGGACCAGG - Intronic
908402837 1:63787198-63787220 AACAGGCCAGGGTGCCTTCCTGG - Intronic
910205040 1:84741541-84741563 GTCTGGCGAGGGTGAGTACTTGG + Intergenic
913957995 1:143320939-143320961 GCCAGGACAGGGTCAGGACCAGG + Intergenic
913958642 1:143323258-143323280 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
914052305 1:144146297-144146319 GCCAGGACAGGGTCAGGACCAGG + Intergenic
914052959 1:144148638-144148660 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
914126238 1:144817903-144817925 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
914126892 1:144820244-144820266 GCCAGGACAGGGTCAGGACCAGG - Intergenic
918002214 1:180508640-180508662 CGCAGGCCAGCGTGAGTTCCAGG + Intergenic
921101245 1:211931232-211931254 TTCAAGCCAGGGTGAGAACCAGG + Intergenic
921196159 1:212759998-212760020 GATAGGGCAGGGTGATTATCAGG - Intronic
922417042 1:225431366-225431388 GACAGGCGTGGGTGGGAACCAGG + Intergenic
923045888 1:230355339-230355361 GTAAGTCCAGGGTGAGTGCCTGG - Intronic
923348392 1:233079903-233079925 GACTAGCCAGAGTGAGTTCCGGG - Intronic
923609073 1:235473405-235473427 GATAGGACTTGGTGAGTACCTGG + Intronic
924305918 1:242689466-242689488 CACAGGCCAGCGTGAGTTCTGGG + Intergenic
924385173 1:243493116-243493138 GACAGGCCAGGGTGTGTGTCTGG - Intronic
924441141 1:244086434-244086456 GACAGGAGAGGGTGGGTTCCTGG - Intergenic
1063497838 10:6526723-6526745 CACAGGCCATGGTGAGAACTTGG + Intronic
1063953127 10:11242738-11242760 GGCCAGCCAGGGTGAGGACCAGG + Intronic
1064353238 10:14596009-14596031 GGCAGGCCACGGTGAGGACGTGG - Intronic
1065983882 10:30930361-30930383 CGCAGGCCAGTGTGAGTTCCAGG - Intronic
1066615090 10:37285488-37285510 CACGGGCCAGGGCGAGTTCCAGG - Intronic
1066759028 10:38737330-38737352 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1066759686 10:38739655-38739677 GCCAGGACAGGGTGAGGACCAGG - Intergenic
1066961937 10:42233107-42233129 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1067171752 10:43912551-43912573 TAAAGGCCAGGGTCAGAACCTGG - Intergenic
1070187314 10:74077049-74077071 GACTGTACACGGTGAGTACCAGG - Intronic
1071149826 10:82620761-82620783 GACAGGGGTGGGTGAGTCCCTGG - Intronic
1071562209 10:86653126-86653148 TGCAGGCCTGGGTGAGTTCCTGG + Intergenic
1073262518 10:102201190-102201212 CACGGGCCAGGGCGAGTTCCAGG - Intergenic
1075031231 10:119026015-119026037 GAAAGGCCAGTGTGGGCACCTGG - Intergenic
1075400647 10:122159177-122159199 GTGAGGCCACGGTGAGGACCTGG + Intronic
1075719360 10:124575908-124575930 GCCAGGGCTGGGTGAGGACCTGG + Intronic
1076789350 10:132768429-132768451 GCCAGGCCTGTGTGAGCACCTGG - Intronic
1077390581 11:2299066-2299088 GACAGGCCAGGGTGCCTCCAGGG + Intronic
1078003106 11:7513605-7513627 GGGAGGCCCGGGTGGGTACCCGG - Intronic
1078560053 11:12363528-12363550 GCCAGGCAAGGGGGAATACCTGG - Intergenic
1080839484 11:35970992-35971014 CACAGGCCTGGCTGAGCACCAGG - Intronic
1081047718 11:38296589-38296611 CACAGGCCAGTGCGAGTTCCGGG - Intergenic
1083864090 11:65444391-65444413 GTCAGGCCAGGGTGAGAGCTGGG - Intergenic
1083961091 11:66015487-66015509 GACAGCCCAGGGTGTGTGCGGGG + Intergenic
1084292064 11:68179020-68179042 GAAAGGCCAGGGTAAATCCCAGG - Intronic
1084549600 11:69833273-69833295 GACAGGTCAGGGTGAGGCCGGGG - Intergenic
1085863097 11:80257601-80257623 TGCAGGCCAGCGTGAGTTCCGGG + Intergenic
1087400984 11:97667120-97667142 CGCAGGCCAGGGGGAGTTCCAGG + Intergenic
1089051831 11:115552358-115552380 GACAGGCCCTGGTGAATTCCAGG - Intergenic
1089634401 11:119803249-119803271 GGCAGGCCAGGGTCAGCCCCTGG - Intergenic
1090245963 11:125216303-125216325 GACAGGCCACGGTGTGACCCTGG + Intronic
1090382762 11:126338469-126338491 GACAGGCCAGCGTGAGAAAGAGG - Intronic
1092344785 12:7706159-7706181 GACAGGCCCGGGGGAGGCCCGGG + Intergenic
1095110863 12:38294263-38294285 CACATGCCAGGGTTAGTTCCTGG + Intergenic
1095921965 12:47540669-47540691 GGCGAGCCAGGGAGAGTACCTGG - Intergenic
1096105665 12:48995857-48995879 CACAGGCCAGGGTCAGTGACAGG + Exonic
1096841618 12:54383361-54383383 GACAGGCCATGGTGACCAACTGG - Intronic
1096966693 12:55633533-55633555 GACAGGCCTGGATGAGGACAGGG + Intergenic
1097044985 12:56180953-56180975 TACAGGCCAGGCTGAGCTCCTGG - Intronic
1101372016 12:104138487-104138509 CACAGGCCCGGGTCAGCACCGGG - Intergenic
1103293410 12:119866037-119866059 GTCAGGGCAGTGTGATTACCAGG - Intronic
1103558496 12:121779873-121779895 GAGAGGCCAGGGTGGGGGCCTGG - Exonic
1103863325 12:124031478-124031500 GACAGGGCAGGGAGAGCATCAGG - Intronic
1104373848 12:128247282-128247304 GGCAGGCCAGCGTGAGTTCCAGG + Intergenic
1105210297 13:18253369-18253391 GACAGGCCAGGGAGGCCACCTGG + Intergenic
1105994897 13:25661187-25661209 GGCAGGCCAGGCTGTGTTCCTGG - Intronic
1106723065 13:32455622-32455644 GGCAGGGCAGGGTGAGCCCCAGG - Intronic
1107714407 13:43185423-43185445 GAAAGCCCAGGGTGCTTACCAGG + Intergenic
1108928061 13:55777830-55777852 GACAGGGCAGGGTGATCCCCGGG - Intergenic
1109124950 13:58505742-58505764 CACAGGCCAGCGTGAGTTCCGGG - Intergenic
1109416477 13:62046860-62046882 GGCAGGCCAGTGCGAGTTCCAGG - Intergenic
1109884354 13:68523981-68524003 CGCAGGCCAGCGTGAGTTCCAGG + Intergenic
1112355952 13:98675203-98675225 GGCAGGCCAGGGTGAAAGCCTGG - Intergenic
1112686430 13:101833114-101833136 GTCAGGCCAGGGTGGGTAGGAGG + Intronic
1112807219 13:103176222-103176244 AATAGGTCAGGGTGAGTTCCAGG + Intergenic
1113521826 13:110946987-110947009 GCCAGGCCAGTGTCAGTCCCAGG - Intergenic
1113706066 13:112433715-112433737 GCCAGGCCAGTGTCAGTCCCAGG + Intronic
1113945179 13:114039882-114039904 GGCAAGCCAGGGTGAGCCCCTGG + Intronic
1114253763 14:20984321-20984343 GACAGGCTAGGATGAGTGACTGG - Intergenic
1114908592 14:27163640-27163662 TGCAGGCAAGGGTGAGTACCTGG + Intergenic
1116084416 14:40217156-40217178 GACAGGCGCGGGTGGGAACCGGG - Intergenic
1118460657 14:65984158-65984180 AAGAGGCCACGGTGAGTACTAGG - Intronic
1122773374 14:104106822-104106844 CACAGGCCAGGCTGGGCACCAGG - Exonic
1123017352 14:105381792-105381814 GACAGGGAAGGGTGAGCACAGGG - Intronic
1202929769 14_KI270725v1_random:26934-26956 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1202930408 14_KI270725v1_random:29210-29232 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1123421962 15:20142275-20142297 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1123422535 15:20144310-20144332 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1123442478 15:20302054-20302076 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1123443116 15:20304360-20304382 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1123531190 15:21148815-21148837 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1123531763 15:21150850-21150872 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1125376422 15:39034919-39034941 GACAGGCCAACGTGGGTACAGGG + Intergenic
1125523246 15:40359545-40359567 GACAGGACAGAGCGAGGACCTGG + Intronic
1126866496 15:52942800-52942822 GACAGGGCAGTCTGGGTACCTGG + Intergenic
1127966014 15:63923456-63923478 GTCAGGCCATGGGGAGAACCAGG + Intronic
1127984725 15:64060852-64060874 GAGAGGCCCGGGTGGGAACCGGG + Intronic
1130195157 15:81772444-81772466 GGCAGGCCAGGCTGAGGACAGGG + Intergenic
1130546417 15:84859922-84859944 GCCAGGCCAGGCTGAGACCCCGG - Intronic
1130991087 15:88876439-88876461 TGCAGGCCAGTGTGAGTTCCTGG + Intergenic
1131286656 15:91064629-91064651 GACAGCCAAGGTTGAGAACCAGG + Intergenic
1131341799 15:91609350-91609372 AACTGGCCAAGCTGAGTACCTGG + Intergenic
1131426648 15:92350782-92350804 GACAGACCTGGGAGGGTACCCGG + Intergenic
1133210443 16:4260630-4260652 GACAGGGCAGGGTGTGCTCCCGG - Intronic
1135680727 16:24454579-24454601 GACAGGGAATGGTGAGGACCAGG - Intergenic
1136718141 16:32301322-32301344 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1136718740 16:32303490-32303512 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1136723121 16:32339593-32339615 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1136723768 16:32341857-32341879 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1136773836 16:32860824-32860846 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1136837111 16:33509754-33509776 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1136841444 16:33545597-33545619 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1136842096 16:33547901-33547923 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1136862217 16:33711050-33711072 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1136862879 16:33713409-33713431 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1136896775 16:34000695-34000717 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1138494464 16:57399208-57399230 GACAGGTCCAGGTGAGAACCAGG - Intergenic
1140188753 16:72796741-72796763 GACTGACCAGGGAGAGAACCTGG - Exonic
1142105121 16:88298474-88298496 GACAGCCCAGGCTGAGACCCTGG + Intergenic
1203002663 16_KI270728v1_random:175908-175930 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1203003310 16_KI270728v1_random:178171-178193 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1203007691 16_KI270728v1_random:214281-214303 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1203008287 16_KI270728v1_random:216443-216465 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1203076256 16_KI270728v1_random:1122935-1122957 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1203123712 16_KI270728v1_random:1559233-1559255 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1203134269 16_KI270728v1_random:1712314-1712336 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1203134918 16_KI270728v1_random:1714578-1714600 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1203146702 16_KI270728v1_random:1807893-1807915 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1203147288 16_KI270728v1_random:1810033-1810055 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1203151609 16_KI270728v1_random:1845894-1845916 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1203152261 16_KI270728v1_random:1848198-1848220 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1144157723 17:12523131-12523153 AACAGGCCAGGGTGGATTCCTGG + Intergenic
1144252866 17:13437317-13437339 GACAGGCAAGGGTTATCACCTGG + Intergenic
1144950999 17:18993328-18993350 GACAGGCCAGAGTGACGACAGGG - Intronic
1146390122 17:32414386-32414408 GGGAGGCCAGGGTGGGTACAGGG - Intergenic
1146447501 17:32944113-32944135 GGCAGGTCAGGGGGAGCACCAGG - Exonic
1146673037 17:34755141-34755163 GTCAGGCCAGGGTCAGGGCCAGG - Intergenic
1146729328 17:35180726-35180748 GGCAGGCCAGGGTCAGGGCCTGG + Intronic
1147263385 17:39221750-39221772 GAGAGGCGAGGGTGAGGCCCAGG - Intronic
1147729012 17:42585500-42585522 GACAGGCCAAGGGCAGAACCTGG + Intronic
1148739401 17:49883937-49883959 GACAAGCCAGGGGAAGTCCCAGG + Intergenic
1151437351 17:74106043-74106065 GACAAGCCAGGGTGCGCACCTGG + Intergenic
1152732436 17:81978886-81978908 GAGAGCCCAGGGTGTGTGCCAGG + Intronic
1154415625 18:14173963-14173985 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1156378657 18:36537128-36537150 GACAGGCCATACTGACTACCTGG - Intronic
1157292595 18:46420520-46420542 GACATGCTAGGGTGGCTACCTGG - Intronic
1157858399 18:51121239-51121261 TGCAGGCCAGCGTGAGTTCCGGG - Intergenic
1158662152 18:59397837-59397859 CACAGGCCAGGGTGGATGCCTGG - Intergenic
1159023330 18:63160887-63160909 GACCTGCCAGAGTGAGTGCCAGG + Intronic
1160633844 19:61728-61750 AAAAGGCCACGGTGAGTCCCAGG + Intergenic
1160847002 19:1170459-1170481 GGCAGGCCAGGACGAGAACCAGG + Intronic
1160940672 19:1619134-1619156 GACAGGTCAGGGAGGGTGCCTGG + Exonic
1161179079 19:2867414-2867436 GACAGGACATGGTGAGTGCAGGG + Exonic
1161357340 19:3826304-3826326 GAGAGGCCTGGCTGAGGACCTGG - Intronic
1161650302 19:5480218-5480240 GAAAGGCCAGGCTGAGGACAAGG + Intergenic
1162987075 19:14277665-14277687 TGCAGGCCAGCGTGAGTTCCAGG + Intergenic
1164742101 19:30583425-30583447 GGCAAGCCAGGGTGACTAGCAGG + Intronic
1166328196 19:42064042-42064064 GACAGGACATGGTGACTAACTGG - Intronic
1167792362 19:51690058-51690080 GACAGGCCAGGGTCAGCGGCGGG + Intergenic
1202691702 1_KI270712v1_random:98721-98743 GCCAGGACAGGGTCAGGACCAGG + Intergenic
932215203 2:69961848-69961870 CACAGGCCAGGGAGGGTACAGGG - Exonic
932442554 2:71747004-71747026 GGCAGGCCAGGGAGAGAGCCTGG - Intergenic
933415795 2:81985214-81985236 CACAGGCCAGTGCGAGTTCCAGG + Intergenic
933780045 2:85795059-85795081 GACAAGGCAGTGTGAGGACCAGG - Intergenic
933782471 2:85811855-85811877 GGCAGGCCTGGGTGGGAACCCGG + Intergenic
933954042 2:87352910-87352932 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
933954687 2:87355229-87355251 GCCAGGACAGGGTCAGGACCAGG - Intergenic
934238245 2:90249153-90249175 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
934274312 2:91565255-91565277 GCCAGGACAGGGTCAGGACCAGG + Intergenic
934274952 2:91567580-91567602 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
934322364 2:91981680-91981702 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
934323003 2:91983994-91984016 GCCAGGACAGGGTCAGGACCAGG - Intergenic
934461318 2:94214792-94214814 GCCAGGACAGGGTCAGGACCAGG - Intergenic
934687855 2:96334814-96334836 TAAAGGCCAGGGTGATTCCCTGG - Intergenic
936509311 2:113132542-113132564 GACAGCCCAGAGTTAGTACAGGG - Intronic
936567632 2:113593287-113593309 AAAAGGCCACGGTGAGTCCCAGG - Intergenic
937215250 2:120308627-120308649 CAAAGGCAGGGGTGAGTACCAGG + Intergenic
940856292 2:158730893-158730915 GAGAGGCCAGGGGGAGGCCCAGG - Intergenic
943134407 2:183892573-183892595 CACGGGCCAGTGTGAGTTCCGGG + Intergenic
944535013 2:200700333-200700355 GCCAGGCCATGGTTAGAACCTGG + Intergenic
945869120 2:215207912-215207934 CACAGGCCAGCGTGAATTCCAGG + Intergenic
946186541 2:217983780-217983802 GGCAGGGCAGGGTGAGTGGCCGG - Intronic
946254323 2:218432012-218432034 ATCAGGCCAGGGTGAGGTCCAGG - Intronic
947640012 2:231701992-231702014 GCCAGACCTGTGTGAGTACCAGG + Intergenic
1169294475 20:4381867-4381889 AACAGCCCAGTGTGGGTACCAGG - Intergenic
1171291441 20:23985059-23985081 GACAGGCCAGGGAGGCCACCTGG + Exonic
1172109239 20:32535901-32535923 GACAGGCCAGGGTCTGGGCCTGG + Intronic
1172128860 20:32642612-32642634 GAGAGGCCAGGGAGATTAGCAGG + Intergenic
1172226525 20:33309051-33309073 GCCAGGCCATGCTGAGCACCGGG - Intronic
1172445429 20:34990822-34990844 GCCAGCCCTGGGTGACTACCTGG - Exonic
1172574464 20:35997027-35997049 AACTGGCCAGGGTGATAACCAGG + Intronic
1173732891 20:45340774-45340796 GAGAGGGGATGGTGAGTACCTGG + Intronic
1173875768 20:46370413-46370435 GAGAGGCCAGTTTGAGTAGCTGG - Intronic
1174411429 20:50339247-50339269 GAGTGGCCAGGGTAAGTCCCTGG - Intergenic
1174690085 20:52495452-52495474 GACATGGCAGGTAGAGTACCTGG + Intergenic
1175129909 20:56781286-56781308 GGCATGCAAGGGTGAGTGCCAGG - Intergenic
1175311920 20:58018283-58018305 GACAGACCATGGTGCGTCCCAGG - Intergenic
1176270157 20:64232132-64232154 GAGAGGCCGGGGTGAGTACAGGG - Intronic
1176369865 21:6056170-6056192 GACAGGCGAGGATGAGGACAAGG - Intergenic
1176591791 21:8655533-8655555 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1176592421 21:8657806-8657828 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1176857703 21:13985313-13985335 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1176865995 21:14055660-14055682 GGTAGGCCAGGGTTAGGACCAGG - Intergenic
1176866896 21:14058886-14058908 GACAGGGCAAGGTCAGTGCCAGG + Intergenic
1177669685 21:24209030-24209052 GACAGGCGCGGGTGGGAACCCGG - Intergenic
1179753654 21:43482371-43482393 GACAGGCGAGGATGAGGACAAGG + Intergenic
1180274638 22:10632645-10632667 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1180275280 22:10634953-10634975 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1180549117 22:16527589-16527611 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1180549755 22:16529888-16529910 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1180765958 22:18346034-18346056 GACAGGCCAGGGAGGCCACCTGG - Intergenic
1180780355 22:18516344-18516366 GACAGGCCAGGGAGGCCACCTGG + Exonic
1180780876 22:18518785-18518807 GAGAGGTCAGGGTGAGTGCTGGG - Intergenic
1180787693 22:18556248-18556270 GAGAGGTCAGGGTGAGTGCTGGG - Intergenic
1180813071 22:18773665-18773687 GACAGGCCAGGGAGGCCACCTGG + Intergenic
1180901477 22:19376496-19376518 GGCTGTCCAGGGTGACTACCAGG - Intronic
1181199248 22:21207981-21208003 GACAGGCCAGGGAGGCCACCTGG + Exonic
1181234046 22:21439058-21439080 GAGAGGTCAGGGTGAGTGCTGGG + Intronic
1181244601 22:21495773-21495795 GAGAGGTCAGGGTGAGTGCTGGG - Intergenic
1181354907 22:22291884-22291906 GCCAGGACAGGGTCAGGACCAGG + Intergenic
1181355581 22:22294263-22294285 GACAGGGCAAGGTCAGCACCAGG + Intergenic
1181702497 22:24628974-24628996 GACAGGCCAGGGAGGCCACCTGG - Exonic
1181878495 22:25958750-25958772 CAGAAGCCAGGGAGAGTACCAGG - Intronic
1182357710 22:29729795-29729817 TACAGGCCAGGGTGGGGACAGGG - Exonic
1183087978 22:35498953-35498975 GAAAGCCCAGGGTGAGTTCTGGG - Intergenic
1183588360 22:38766222-38766244 GCCAAGCCAGGGTGAGTCACAGG - Intronic
1183658489 22:39204884-39204906 GCCAGGACAGGGTGCTTACCTGG - Intergenic
1184255709 22:43285667-43285689 GACAGGGCGGGGTGAGGAGCAGG + Intronic
1184650714 22:45918380-45918402 GACAGGGCAGGGTGGGAGCCAGG + Intergenic
1185070075 22:48651354-48651376 GACAGGCCGGGCTGACTGCCAGG + Intronic
1203227577 22_KI270731v1_random:86925-86947 GACAGGCCAGGGAGGCCACCTGG - Intergenic
950083338 3:10239230-10239252 GACAGGACTGGGTGATTAACCGG - Intronic
953790282 3:45942219-45942241 GACAGTCCTGGGTGACTGCCAGG + Intronic
954214272 3:49115837-49115859 GACAGGCCAGGAGGAGGCCCGGG - Exonic
954682754 3:52354809-52354831 GACAAGCCAGGCTGAGTCCTGGG - Intronic
954698948 3:52441786-52441808 CCCAGGCCAGGGTGAGAACAGGG - Intronic
955326108 3:58010189-58010211 CACAGGCCAGGGCCAGTCCCTGG - Intronic
957209459 3:77240405-77240427 CGCAGGCCAGCGTGAGTTCCGGG - Intronic
960560070 3:119073722-119073744 CACAGGCCAGCGCGAGTTCCGGG - Intronic
961109322 3:124270649-124270671 GTCAGGCCAGGGTCAGACCCAGG - Intronic
961315459 3:126032463-126032485 GACAGGACAGGGTGATGTCCAGG + Intronic
961624729 3:128254086-128254108 GACAGGAGAGCCTGAGTACCTGG + Intronic
962203448 3:133417357-133417379 GAGAGGGCAGGGTGAGTAGAGGG - Intronic
962382792 3:134910901-134910923 AACAGGACAGGGTGAGAACTGGG + Intronic
963288785 3:143465194-143465216 CACTGGCCAGGCTGACTACCAGG + Intronic
964138386 3:153370080-153370102 CACAGGCCAGTGTGAGTTCCAGG - Intergenic
964983182 3:162710831-162710853 TGCAGGCCAGCGTGAGTTCCGGG - Intergenic
968998996 4:3965014-3965036 TGCAGGCCAGCGTGAGTTCCGGG - Intergenic
969313473 4:6367781-6367803 AACAGGCCATGGGGAGCACCAGG + Intronic
973993760 4:56436318-56436340 GACAGCTGAGGGTGAGTAACAGG + Exonic
974299276 4:60042539-60042561 CGCAGGCCAGCGTGAGTTCCAGG - Intergenic
974411922 4:61552949-61552971 GTCAGACCATGGTGAGTTCCGGG + Intronic
976846045 4:89490096-89490118 TGCAGGCCAGTGCGAGTACCAGG + Intergenic
977885133 4:102245082-102245104 CACAGGCCAGCGTGAGTTCCGGG + Intergenic
980595461 4:134948471-134948493 CACAGGCCAGGGTGAGTTCCAGG - Intergenic
982768908 4:159378137-159378159 TGCCGGCCAGGGTGAGTTCCGGG + Intergenic
982892810 4:160877278-160877300 GGCAGACCAGGATGAGTACCTGG + Intergenic
983433493 4:167681439-167681461 CACAGGCCAGGGTAGGTCCCAGG - Intergenic
985605916 5:858009-858031 GACAGGCCTGGGACAGGACCGGG - Intronic
985605952 5:858154-858176 GACAGGCCTGGGACAGGACCGGG - Intronic
985763287 5:1762883-1762905 GCCAGGCCAGGGTGTGACCCTGG - Intergenic
985972892 5:3392179-3392201 GAGAGGCCAGGGTGACTGACTGG + Intergenic
985972915 5:3392246-3392268 GAGAGGCCAGGGTGACTGACTGG + Intergenic
986298174 5:6456691-6456713 AGCAGGCCAGGGAGAGGACCAGG - Intronic
988143086 5:27267518-27267540 CACAGGCCAGCATGAGTTCCGGG - Intergenic
989777358 5:45225673-45225695 CCCAGGCCAGCGTGAGTTCCGGG + Intergenic
994570271 5:101506067-101506089 TGCAGGCCAGTGTGAGTTCCGGG + Intergenic
996575918 5:124976418-124976440 CACAGGCCAGCATGAGTTCCTGG - Intergenic
996681161 5:126229143-126229165 CACAGGCCAGCGTGGGTTCCGGG + Intergenic
996747127 5:126854851-126854873 TGCAGGCCAGCGTGAGTTCCGGG - Intergenic
998415016 5:141939919-141939941 GCTGGGCCAGGGTGAGGACCTGG + Exonic
999239140 5:150117599-150117621 CCCAGGCCAGGGTGGTTACCTGG + Exonic
999515405 5:152297172-152297194 CAGAGCCCAGGGAGAGTACCTGG + Intergenic
1002449091 5:179308940-179308962 GCCAGGCCATGGTGAGGCCCTGG + Intronic
1002454351 5:179337817-179337839 AGCAGGCCTGGGTGAGGACCTGG + Intronic
1002454373 5:179337916-179337938 AGCAGGCCTGGGTGAGGACCTGG + Intronic
1002461999 5:179378524-179378546 GCCTGGCCAGGGTGAGTAACAGG - Intergenic
1003061929 6:2870387-2870409 CACAGGCCAGCATGAGTTCCAGG - Intergenic
1004499708 6:16198448-16198470 GACAGGCAAGGGTGGGAACCGGG - Intergenic
1005690138 6:28296991-28297013 GCCAAGCCAGGGTGAGTGACAGG - Intronic
1005725086 6:28640062-28640084 TGCGGGCCAGGGTGAGTTCCGGG - Intergenic
1005956880 6:30670398-30670420 GGAAGGCCATGGTGAGTCCCAGG - Exonic
1006387363 6:33738841-33738863 GACAGGCCAGGGGGTAGACCAGG - Intronic
1006793504 6:36718192-36718214 GACTGGCCAGGGTGGGGAACAGG + Intronic
1007168843 6:39848043-39848065 GGCATGCCAGAGTGAGAACCTGG - Intronic
1007245831 6:40461713-40461735 GAGAGGCGAGGGAGATTACCAGG + Intronic
1007417563 6:41700909-41700931 GACAGGACAGGGCGACTCCCTGG - Intronic
1007430756 6:41775407-41775429 GACAGGCCAGGGTGAGTACCAGG - Exonic
1008567802 6:52786517-52786539 GAGAGGCATGGGTGAGAACCTGG + Intergenic
1008844809 6:55950350-55950372 CACAGGCCAGTGCGAGTTCCGGG + Intergenic
1009537637 6:64909001-64909023 GACAGATAAGGGTGGGTACCCGG - Intronic
1009615520 6:65999686-65999708 CACGGGCCAGCGTGAGTTCCAGG - Intergenic
1010180841 6:73085174-73085196 GATGGGTCAGGGTGAATACCTGG + Intronic
1011125820 6:84006502-84006524 AACATGCAAGGGTGACTACCTGG + Intergenic
1012850970 6:104446376-104446398 TGCAGGCCAGCGTGAGTTCCGGG + Intergenic
1013745610 6:113342261-113342283 GACAAGCCAGTGTGTGTATCTGG - Intergenic
1014638117 6:123874101-123874123 GACAGGTCAGGGTTAAAACCTGG - Intronic
1015642573 6:135351620-135351642 GAGCGGCCAGAGTGAGTACTGGG + Intronic
1016430118 6:143974436-143974458 GACAGTCCAAGGTGAGTAATTGG - Intronic
1017235176 6:152111325-152111347 GCCAGGCCAGGCTGGGTGCCTGG + Intronic
1017759469 6:157556819-157556841 GACAGGCCCGGGCGGGTTCCAGG + Intronic
1019147647 6:169985288-169985310 GAGAGGCCAGGGTGAGGGCTTGG + Intergenic
1019579016 7:1750963-1750985 CACAGGCCAGGGTGAGCCGCGGG + Intergenic
1019905220 7:4057295-4057317 GACAGGGCAGGGTGAGCCCAGGG - Intronic
1021839767 7:24713202-24713224 GACAGGCCTTGCTGAGTTCCTGG - Intronic
1024126488 7:46302838-46302860 GAAGGTCCAGGGTGAGTACTGGG + Intergenic
1026629647 7:72027293-72027315 GACATTCCAGAGGGAGTACCTGG - Intronic
1029065372 7:97843185-97843207 CACAGGCCAGCGCGAGTTCCAGG - Intergenic
1029346220 7:99980671-99980693 TACAGGCCAATGGGAGTACCAGG - Intergenic
1029536630 7:101161148-101161170 GAAAGGCCAGGGCCAGGACCAGG - Exonic
1029558957 7:101289844-101289866 TACAGGCCAATGGGAGTACCAGG + Intergenic
1031280763 7:119797032-119797054 CACTGCCCAGGGTGAGTCCCAGG - Intergenic
1032030208 7:128476872-128476894 GAGGGGGCAGGGTGATTACCAGG - Exonic
1035046920 7:155973842-155973864 GCCAGGCCATGGTGGGTCCCTGG + Intergenic
1035373108 7:158391770-158391792 GCCAGGCCCTGGTCAGTACCGGG + Intronic
1035554427 8:555609-555631 GACAGGCCAGGGTGATTCCTGGG + Intergenic
1036378251 8:8218975-8218997 GGCAGGCCAGTCTGAGTGCCGGG - Intergenic
1037696335 8:21227413-21227435 TACAGTCCAGGGTGAGGAACAGG + Intergenic
1039385100 8:37128711-37128733 GACAGGGAATGGGGAGTACCAGG + Intergenic
1040026523 8:42786815-42786837 TGCAGGCCAGCGTGAGTTCCAGG + Intronic
1044347317 8:91120426-91120448 GACAGGGCAGGGAAAGAACCTGG + Intronic
1045011404 8:97961964-97961986 GACAGGCCAAAGTGACTGCCAGG + Intronic
1045390324 8:101708740-101708762 GAGACCCCAGGGTGAGTACCTGG - Intronic
1048375804 8:133821548-133821570 GAGAGGACAGGGCGAGTATCTGG + Intergenic
1049194364 8:141307670-141307692 GACAAGACAGGGTCAGGACCAGG + Intronic
1049224102 8:141441467-141441489 CACAGGCCAGGGTGAGGGCCGGG + Intergenic
1049395343 8:142397658-142397680 CCCAGGCCAGCGTGAGTGCCTGG + Intronic
1049439493 8:142602714-142602736 GCCAGGCCAGGGTGGGTGCCAGG + Intergenic
1049618894 8:143589012-143589034 GACAGGCCAGACCGAGGACCGGG + Exonic
1049884901 9:20233-20255 AAAAGGCCACGGTGAGTCCCAGG + Intergenic
1053286780 9:36854920-36854942 GGCAGGCCTGGGTGAGCCCCAGG + Intronic
1055985536 9:82054653-82054675 TGCAGGCCAGCGTGAGTTCCGGG - Intergenic
1057928222 9:99171192-99171214 GACAGGGCAGGCTGAGCCCCAGG - Intergenic
1058502735 9:105637786-105637808 GAGAGGACTGGGTGACTACCTGG - Exonic
1059306539 9:113357858-113357880 TACAGGCCAGGCACAGTACCGGG - Intronic
1059404797 9:114093031-114093053 GACAGGGCAGGGTGAGGAGGGGG + Intronic
1060736660 9:126070525-126070547 GACAGGCCAGGGAAAGGAACAGG - Intergenic
1061917663 9:133763610-133763632 GACAGGCAAGGCTGAGTCCAGGG + Exonic
1062443832 9:136585140-136585162 GGCAGCCCAGGGTGAGCACGTGG + Intergenic
1203621832 Un_KI270749v1:134352-134374 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1203622474 Un_KI270749v1:136639-136661 GCCAGGACAGGGTCAGGACCAGG - Intergenic
1189738545 X:44095642-44095664 TACAGGCTGGGGTGATTACCAGG - Intergenic
1190893851 X:54596927-54596949 GGGAGGGCAGGGTGAGTCCCAGG - Intergenic
1193328319 X:80207632-80207654 GCCAGGCCAGGGAGAGAACAAGG - Intergenic
1194185101 X:90765701-90765723 CACAGGCCAGTGTGGGTTCCAGG + Intergenic
1199456693 X:148037293-148037315 TGCAGGCCATGGTGAGTACTGGG + Intergenic
1201189849 Y:11436855-11436877 GACAGGGCAAGGTCAGTGCCAGG - Intergenic
1202583777 Y:26405083-26405105 GACAGGGCAAGGTCAGTGCCAGG + Intergenic