ID: 1007430758

View in Genome Browser
Species Human (GRCh38)
Location 6:41775418-41775440
Sequence CGCCGATGTCAGACAGGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430758_1007430765 3 Left 1007430758 6:41775418-41775440 CCCTGGCCTGTCTGACATCGGCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430758_1007430763 -1 Left 1007430758 6:41775418-41775440 CCCTGGCCTGTCTGACATCGGCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430758_1007430762 -9 Left 1007430758 6:41775418-41775440 CCCTGGCCTGTCTGACATCGGCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430758 Original CRISPR CGCCGATGTCAGACAGGCCA GGG (reversed) Exonic
903002784 1:20278134-20278156 TGCCCATGTTACACAGGCCATGG + Intergenic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
906946758 1:50301039-50301061 CACCTATGGCAGAAAGGCCAGGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
1075636315 10:124033194-124033216 CAACCATTTCAGACAGGCCATGG + Intronic
1077202424 11:1317720-1317742 AGCAGCTGTCAGACTGGCCAGGG - Intergenic
1077487010 11:2843588-2843610 CGTGGATGGCAGACTGGCCAGGG - Intronic
1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG + Intronic
1087777324 11:102268510-102268532 CGCAGAAGTCAGTCAGGCCGTGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089594188 11:119566447-119566469 TGCCGGAGTCAGACAGGCTAGGG + Intergenic
1090364412 11:126193547-126193569 AGTCCATGTCAGACAGGCCGTGG + Intergenic
1102349961 12:112184798-112184820 CGCCGATGCCTGCCAGGCCCTGG - Exonic
1105305681 13:19167224-19167246 AGCTGATATCAGACAGCCCAAGG + Intergenic
1107411891 13:40165534-40165556 CCCCGATGTCAGAAAAGACAGGG + Intergenic
1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG + Intronic
1108269924 13:48749372-48749394 TACTGATGTCAGACAGGCCTGGG + Intergenic
1117254163 14:53961599-53961621 CGTGGATGGCAGACAGGGCATGG + Intergenic
1119613065 14:76080168-76080190 CAGCGATGACAGCCAGGCCAAGG - Intronic
1131594257 15:93781046-93781068 CTCCGAGGTCAGTCAGACCAGGG - Intergenic
1132115950 15:99136780-99136802 TGCTGATGTCCGACAGGCCTGGG + Exonic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1133914824 16:10100066-10100088 GGCCCATGTCAGACAGGTGAAGG + Intronic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1138456189 16:57122117-57122139 CGCTGATGCCAGAGAGGACAGGG - Intronic
1141513063 16:84525089-84525111 AGCCAATGTGAGACAGGGCATGG + Intronic
1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG + Exonic
1160679838 19:407614-407636 CGCCCAGGACAGCCAGGCCAAGG - Exonic
1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG + Exonic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1168241549 19:55091540-55091562 CGCGGAGGTCAGACAGGGCCTGG + Exonic
927864330 2:26579070-26579092 CACAGATGTCAGACAGACCTGGG - Intronic
929004047 2:37378500-37378522 GGCCAATGGCAGTCAGGCCAAGG - Intergenic
929484832 2:42343785-42343807 CCTCAATGTCAGACAAGCCAGGG + Intronic
1170517500 20:17147045-17147067 CCCCAATGCCCGACAGGCCATGG - Intergenic
1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG + Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG + Intergenic
1175780201 20:61677211-61677233 CGCAGATATCACAGAGGCCAGGG - Intronic
1175965444 20:62658004-62658026 CGGCCATGTCGGACGGGCCATGG - Intronic
1179819440 21:43928183-43928205 CGACGGTTTCAGGCAGGCCAAGG + Intronic
1180117360 21:45719099-45719121 CCCCGAATTCAGCCAGGCCAGGG - Intronic
1183305579 22:37081380-37081402 TGTCGAAGCCAGACAGGCCAGGG - Intronic
955026607 3:55173639-55173661 TGCCAATGTTAGAGAGGCCACGG + Intergenic
956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG + Intronic
957837347 3:85613826-85613848 CTCTGAAGTCTGACAGGCCAGGG + Intronic
959426232 3:106192458-106192480 TGCTGATGGCAGACAGGCTAGGG - Intergenic
968327821 3:197835732-197835754 GGCCGAGGTGAGACAGCCCAAGG + Exonic
970085468 4:12341147-12341169 CACCTCTGTTAGACAGGCCATGG - Intergenic
973942032 4:55920822-55920844 AGCTGAAGTCAGACAAGCCAGGG - Intergenic
977557710 4:98501741-98501763 AGCAAATGTCACACAGGCCATGG + Intronic
985064338 4:186105580-186105602 CGCCGATGTCAGGCAGCGTAAGG - Intronic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
997440690 5:133906826-133906848 GGCTGAGGTCAGAGAGGCCAAGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1021502522 7:21346403-21346425 CTCCAAAGTCAGACAGGCCCAGG + Intergenic
1022822326 7:33973838-33973860 ACCCCATGTCACACAGGCCATGG - Intronic
1047763262 8:127969839-127969861 CCTCTATGTCAGACAGGCCAGGG - Intergenic
1055977011 9:81965462-81965484 GGAAGATGTCAGACAGGGCAGGG + Intergenic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1062318909 9:135981000-135981022 CGCTGATGCCAGCCTGGCCATGG - Intergenic
1062445312 9:136591316-136591338 TGCGGAGGTCAGACAGACCATGG + Intergenic