ID: 1007430759

View in Genome Browser
Species Human (GRCh38)
Location 6:41775419-41775441
Sequence CCGCCGATGTCAGACAGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430759_1007430763 -2 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430759_1007430765 2 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430759_1007430762 -10 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430759 Original CRISPR CCGCCGATGTCAGACAGGCC AGG (reversed) Exonic
900995607 1:6121723-6121745 CCGGCTAAGTCAGAGAGGCCAGG + Intronic
906027052 1:42682679-42682701 CCGCCGATGTGAGGCCGCCCGGG - Exonic
908128868 1:61054731-61054753 CCGTCGAGGGCAGGCAGGCCTGG - Intronic
913370311 1:118091911-118091933 CAGCCGATTTCATACATGCCTGG + Exonic
914375961 1:147073824-147073846 CTGCTGTTGTCAGACATGCCTGG + Intergenic
914507262 1:148300627-148300649 CTGCTGTTGTCAGACGGGCCTGG - Intergenic
918072483 1:181143092-181143114 CAGCAGATGTCACAGAGGCCTGG - Intergenic
920267022 1:204731614-204731636 CCGCCCAGGTGAGACAGGGCTGG - Intergenic
923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG + Intergenic
924625599 1:245694678-245694700 ACGCAGCTGTCAGCCAGGCCTGG + Intronic
1065491751 10:26289347-26289369 CCTCTGTTGTCAGACATGCCTGG + Intronic
1077202425 11:1317721-1317743 CAGCAGCTGTCAGACTGGCCAGG - Intergenic
1081812918 11:45923219-45923241 CCGCAGATGTCCAAGAGGCCGGG - Intronic
1089395501 11:118134136-118134158 CCCCTGATGTTAGAGAGGCCTGG - Exonic
1096814167 12:54191251-54191273 CAGCCAATGTCAGAGGGGCCTGG + Intergenic
1097374835 12:58829307-58829329 CCACTGAAGTCATACAGGCCTGG - Intergenic
1104178078 12:126351900-126351922 CAGCTGAGGTCACACAGGCCTGG - Intergenic
1107411889 13:40165533-40165555 CCCCCGATGTCAGAAAAGACAGG + Intergenic
1107666510 13:42696273-42696295 GAGCCGATGTGAGACAAGCCTGG + Intergenic
1108269923 13:48749371-48749393 TTACTGATGTCAGACAGGCCTGG + Intergenic
1114295391 14:21324754-21324776 CGGCAGATGTCAGGAAGGCCTGG - Exonic
1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG + Intergenic
1121796181 14:96737328-96737350 CCGACCATGTGGGACAGGCCTGG - Intergenic
1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG + Intergenic
1122925799 14:104899211-104899233 CCTCGGATGTGATACAGGCCTGG + Intergenic
1124159419 15:27255102-27255124 CAGCCGCTGTCAGGCAGCCCTGG - Intronic
1125265133 15:37870246-37870268 CCGCCAGTGACAGACATGCCAGG - Intergenic
1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG + Intronic
1132115949 15:99136779-99136801 CTGCTGATGTCCGACAGGCCTGG + Exonic
1138223766 16:55275305-55275327 CTTCTGAAGTCAGACAGGCCTGG - Intergenic
1140091965 16:71846128-71846150 CCGCCGGGGCCAGGCAGGCCTGG + Intronic
1147215302 17:38895858-38895880 CCTCAGATGTCAGTCAGTCCTGG + Intronic
1148432222 17:47650834-47650856 CGGCCGGGGTCAGACAGGGCGGG - Intronic
1152608559 17:81304830-81304852 CGGCAGAGGGCAGACAGGCCAGG - Intergenic
1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG + Exonic
1167637291 19:50662341-50662363 CCACGGATGTCAAAGAGGCCTGG + Exonic
927864331 2:26579071-26579093 ACACAGATGTCAGACAGACCTGG - Intronic
934321440 2:91974984-91975006 CCGGCGGTGGCAGCCAGGCCAGG + Intergenic
937422039 2:121765383-121765405 CCGCTGAGGTCAGCAAGGCCAGG - Exonic
944278483 2:197867215-197867237 CCGCCCACATCAGTCAGGCCAGG - Intronic
946378208 2:219327085-219327107 CCCCTCATGCCAGACAGGCCTGG - Intergenic
946843697 2:223840697-223840719 CTGCCCATCTCAGCCAGGCCAGG - Intergenic
948197097 2:236104250-236104272 CTGCCCATGTCAGCCTGGCCTGG - Intronic
1174359216 20:50017395-50017417 CAGCCAATGAGAGACAGGCCTGG + Intergenic
1176178387 20:63739021-63739043 CCGCGGCTGTCAGAGCGGCCAGG - Exonic
1183798060 22:40137348-40137370 CCTCTGGAGTCAGACAGGCCTGG - Intronic
956891911 3:73622252-73622274 CTGCAGCTGACAGACAGGCCAGG + Intronic
973942033 4:55920823-55920845 CAGCTGAAGTCAGACAAGCCAGG - Intergenic
975565104 4:75745955-75745977 CAGCCGCTGTAACACAGGCCAGG + Intronic
980075481 4:128288562-128288584 CTGCCGATGCCAGAGAAGCCCGG - Exonic
990902819 5:60771537-60771559 ACTCTGATGTCAGACAGACCTGG + Intronic
994620654 5:102157566-102157588 CTGCAGATTTCAGACATGCCTGG - Intergenic
1002485227 5:179530543-179530565 CCGGCGACCTCAGACAGACCGGG - Intergenic
1004143623 6:13044797-13044819 CAGCGGGTGTCAGTCAGGCCTGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1017141228 6:151191786-151191808 CTGCGCATGTCAGACAGACCTGG - Intergenic
1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG + Intergenic
1019060472 6:169254051-169254073 CGGCCCCTGCCAGACAGGCCTGG + Intergenic
1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG + Intronic
1037545534 8:19916489-19916511 GAGCCGTTGTAAGACAGGCCTGG + Intronic
1047763264 8:127969840-127969862 GCCTCTATGTCAGACAGGCCAGG - Intergenic
1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG + Intergenic
1060862313 9:126964605-126964627 CCTCTGAGGTCAGATAGGCCTGG - Intronic
1061141345 9:128769074-128769096 CCGCTGCTGTCAGAAAAGCCAGG + Intronic
1061486378 9:130922556-130922578 CAGCAGATGTCAGAGAGGCGGGG - Intronic
1197226778 X:123961943-123961965 CCGCCCATGCCAGGCAGGCAGGG - Intronic
1201188823 Y:11429729-11429751 CCTGCCATGTCCGACAGGCCCGG + Intergenic