ID: 1007430759

View in Genome Browser
Species Human (GRCh38)
Location 6:41775419-41775441
Sequence CCGCCGATGTCAGACAGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430759_1007430765 2 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430759_1007430763 -2 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430759_1007430762 -10 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430759 Original CRISPR CCGCCGATGTCAGACAGGCC AGG (reversed) Exonic