ID: 1007430762

View in Genome Browser
Species Human (GRCh38)
Location 6:41775432-41775454
Sequence ACATCGGCGGCCACTCTCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430754_1007430762 18 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430759_1007430762 -10 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430751_1007430762 24 Left 1007430751 6:41775385-41775407 CCTATCCCAGGGTGGAGCAGGGC 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430747_1007430762 26 Left 1007430747 6:41775383-41775405 CCCCTATCCCAGGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430756_1007430762 2 Left 1007430756 6:41775407-41775429 CCTGGTACTCACCCTGGCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430749_1007430762 25 Left 1007430749 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 330
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430758_1007430762 -9 Left 1007430758 6:41775418-41775440 CCCTGGCCTGTCTGACATCGGCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1007430753_1007430762 19 Left 1007430753 6:41775390-41775412 CCCAGGGTGGAGCAGGGCCTGGT 0: 1
1: 0
2: 5
3: 44
4: 456
Right 1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430762 Original CRISPR ACATCGGCGGCCACTCTCAA AGG Exonic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
905583201 1:39097836-39097858 GCATTGGCCACCACTCTCAAGGG + Intronic
917223876 1:172761240-172761262 ACATGGGCAGCCTCTCTCACAGG + Intergenic
1076064817 10:127440787-127440809 ACATCCTCGGCCACCCTCATGGG - Intronic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1093806914 12:23445715-23445737 ACATTGGCAGGCACTATCAAGGG + Intergenic
1102804294 12:115765756-115765778 ACATCGGCAGCCACTGTCCTGGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1143036966 17:4004987-4005009 ACAGCGGCGGCCACTGCCATAGG + Exonic
1151329669 17:73399322-73399344 ACATGGGGGGCCATTCTCACCGG - Intronic
1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG + Intronic
1156327114 18:36084971-36084993 ACAGCAGCGGCCACTCTAGATGG - Intergenic
1159676585 18:71291181-71291203 ACATGCTAGGCCACTCTCAAAGG + Intergenic
1164569781 19:29364908-29364930 ACATCCGTGGCCACCCTCAGTGG - Intergenic
932894227 2:75623123-75623145 ACACCTGTGGCCACTCTCCAAGG - Intergenic
1173714891 20:45194865-45194887 ACATAGGTGACCACTCTCATTGG - Intergenic
1176241800 20:64078898-64078920 AAAGCGGCAGCCACTCCCAAGGG - Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
964505584 3:157395424-157395446 ACATGGACGTCCACTCACAAAGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977708263 4:100095413-100095435 ACATCAATGGCCACTTTCAAAGG + Intergenic
981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG + Intronic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
996435754 5:123430905-123430927 CCATCGGCGCCCAGTCCCAAGGG + Intergenic
997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG + Intergenic
1003494725 6:6654004-6654026 ACATCAGCTTCCACTCTGAAAGG - Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1010415127 6:75602832-75602854 ACTTCAGCGCGCACTCTCAAAGG - Intronic
1023541592 7:41272065-41272087 ACACCGGAGGCAACTCTTAAAGG - Intergenic
1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG + Intergenic
1037928923 8:22865772-22865794 AGATCGGCGGCCACTCCCGGGGG + Intronic
1193070820 X:77303778-77303800 TCATCAACTGCCACTCTCAAGGG + Intergenic