ID: 1007430763

View in Genome Browser
Species Human (GRCh38)
Location 6:41775440-41775462
Sequence GGCCACTCTCAAAGGAGAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430759_1007430763 -2 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430754_1007430763 26 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430761_1007430763 -7 Left 1007430761 6:41775424-41775446 CCTGTCTGACATCGGCGGCCACT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430758_1007430763 -1 Left 1007430758 6:41775418-41775440 CCCTGGCCTGTCTGACATCGGCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430753_1007430763 27 Left 1007430753 6:41775390-41775412 CCCAGGGTGGAGCAGGGCCTGGT 0: 1
1: 0
2: 5
3: 44
4: 456
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1007430756_1007430763 10 Left 1007430756 6:41775407-41775429 CCTGGTACTCACCCTGGCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430763 Original CRISPR GGCCACTCTCAAAGGAGAAG AGG Exonic
903237943 1:21962456-21962478 TGCCACCCTCCAAGAAGAAGGGG - Intergenic
903793264 1:25908912-25908934 TGCCCCTCTCCAAGGTGAAGTGG - Intergenic
906142754 1:43543533-43543555 GGCCAAACACAAAGGAAAAGGGG - Intronic
906431949 1:45762158-45762180 AGCCACTCCCAAAGGAGAATGGG + Intergenic
906560244 1:46751234-46751256 TGCAACTGGCAAAGGAGAAGAGG - Intergenic
907145274 1:52225326-52225348 AGCCCCTCCCAAAGGAGAATGGG + Intronic
910481602 1:87664099-87664121 GGGCACTCTCAAATGATAATGGG - Intergenic
911790207 1:102005509-102005531 AGCCACTCTTAATGGAAAAGAGG - Intergenic
916265493 1:162886442-162886464 GGCCACTGTCTAAAGGGAAGAGG + Intergenic
916473144 1:165143177-165143199 GGCCACTGTTACTGGAGAAGAGG + Intergenic
917220931 1:172727805-172727827 GGGCACTCTCAAGGGAAGAGAGG - Intergenic
917770416 1:178271141-178271163 GGTAGCTCTCAATGGAGAAGAGG - Intronic
918062671 1:181075464-181075486 CCTCTCTCTCAAAGGAGAAGGGG - Intergenic
918424039 1:184390012-184390034 GGCCACCCTCAAAGTAGAGCTGG - Intronic
919024069 1:192145882-192145904 GCCCACCCTCAAAGGGGAAGAGG - Intergenic
919471301 1:197982142-197982164 GAAAACTCTCAAAGGAGATGTGG + Intergenic
919781617 1:201224913-201224935 GGCCACTCACCAAGGCAAAGAGG + Intronic
920111920 1:203592828-203592850 GGCCACTCTGAGAAGAGGAGGGG - Intergenic
920230628 1:204467378-204467400 GGGGACTCTCTTAGGAGAAGCGG + Intronic
921530015 1:216270588-216270610 GGCAATTCTGAAAGAAGAAGTGG - Intronic
924699325 1:246435151-246435173 GGTGACTATTAAAGGAGAAGAGG + Intronic
924938816 1:248795636-248795658 TGCCACCCTAATAGGAGAAGGGG - Intergenic
1064135897 10:12750569-12750591 GGCCAAACTCAGAGCAGAAGAGG + Intronic
1064241266 10:13631768-13631790 GGCCCTTCTCAATGCAGAAGTGG - Intronic
1066403038 10:35093235-35093257 GGCCAGTCACATAGGAGAACTGG - Intergenic
1067796002 10:49322762-49322784 GGCCACACCCAGAGGAAAAGTGG + Exonic
1068576462 10:58689320-58689342 GGCCACAGACAAGGGAGAAGAGG - Intronic
1073427550 10:103464932-103464954 GGCCACCCTCAGAGAAGAATGGG - Intergenic
1075107362 10:119549693-119549715 AGCCACTCTCAAAGGTGACTTGG + Intergenic
1078665351 11:13320361-13320383 GGGCACCCTCAAAGGATAAATGG - Intronic
1080699777 11:34634882-34634904 GGCCACTCTCTGCTGAGAAGAGG - Intronic
1081023838 11:37983355-37983377 GGCCCATCTCAATGGATAAGTGG - Intergenic
1081890951 11:46542189-46542211 GCACACTCTCAAAGGAGCTGGGG + Exonic
1081982203 11:47274808-47274830 AGCGAATCTCTAAGGAGAAGGGG + Exonic
1082224924 11:49693798-49693820 GTGCACTCTCAAAGGAGCACAGG - Intergenic
1085741739 11:79083149-79083171 GGGCAGTCTGAATGGAGAAGAGG + Intronic
1087155427 11:94897087-94897109 GGTCACTGAAAAAGGAGAAGAGG - Intergenic
1088219282 11:107550513-107550535 GGCCACTCTTAAAGACGCAGAGG - Intronic
1088505789 11:110525668-110525690 GGCCTCTCTCCCAGGAGCAGAGG + Intergenic
1089320332 11:117622118-117622140 GACCCCTTTAAAAGGAGAAGAGG + Intronic
1090537349 11:127657961-127657983 GGGGTCTCTCAAAGGAGAAGAGG - Intergenic
1091327127 11:134699832-134699854 GGGGACTCCCAGAGGAGAAGGGG + Intergenic
1095710626 12:45284430-45284452 GGCCAGCCTCAGGGGAGAAGGGG + Intronic
1095942349 12:47735434-47735456 GGCCACTCCCAGAGGACAGGAGG - Intronic
1096227049 12:49872664-49872686 GGCCACCGTCAAAGGTGAGGAGG + Intronic
1096718562 12:53505250-53505272 AGCCACTCACAATGGAGAAGTGG - Exonic
1097180104 12:57166949-57166971 GGCCACTGGCACAGGAGAACTGG - Exonic
1097218743 12:57434429-57434451 GGAGACTCTCAAACAAGAAGGGG - Intergenic
1099365082 12:81758697-81758719 GACCATTGTCAAAGGAGGAGAGG + Intronic
1101216868 12:102594280-102594302 GGCCACTCTACAAGCAGCAGAGG - Intergenic
1102115189 12:110397592-110397614 TGCCACTATAAAAGGAGAATGGG + Intronic
1102454660 12:113064035-113064057 GAGCGCTCTCAAGGGAGAAGGGG - Intronic
1102722011 12:115024467-115024489 TGCCACGCTCGAAGGAGAAAGGG - Intergenic
1102777687 12:115534874-115534896 GACACCTCTGAAAGGAGAAGGGG + Intergenic
1104978535 12:132562684-132562706 GGCCCCTCGGAAAGGAGCAGCGG - Intronic
1105025107 12:132843079-132843101 GGCCACTGGAAAAAGAGAAGGGG + Exonic
1109568077 13:64145127-64145149 AGCCACTCTGTAAGGTGAAGAGG + Intergenic
1110436609 13:75482687-75482709 GGCCACTCGCAGTGGAGAACTGG + Intergenic
1111909797 13:94298349-94298371 GGCCTTTCTCAAAGTGGAAGTGG - Intronic
1114427250 14:22634268-22634290 GTCCACTGTCACAGAAGAAGTGG + Exonic
1114441125 14:22748897-22748919 AGCCCCTGTCAAAGGAGAAGGGG + Intergenic
1118877729 14:69798630-69798652 AGAGACTCTCAAAGGAAAAGAGG - Intergenic
1118923483 14:70170884-70170906 GACCTCACTCAGAGGAGAAGAGG + Intronic
1122551368 14:102551956-102551978 AGCCCCTCTCCTAGGAGAAGAGG + Intergenic
1122709220 14:103643263-103643285 GCCCACACTCCAAGGAGATGGGG - Intronic
1122733876 14:103823416-103823438 TGTTATTCTCAAAGGAGAAGGGG + Intronic
1125496118 15:40195668-40195690 GGCCATTCTCACAGGAGTAAGGG + Intronic
1126677498 15:51173213-51173235 GGGCACTCTCTATGCAGAAGTGG - Intergenic
1127475427 15:59328091-59328113 TCCCCCTCTCAAAGGAGATGGGG + Intronic
1128742031 15:70090410-70090432 GACCACTTGCAAAGTAGAAGGGG - Intronic
1130785097 15:87087310-87087332 GGCCACTGTTGAAGGGGAAGAGG + Intergenic
1132673846 16:1113717-1113739 GGCCACTCTCCCAGGAGCTGTGG + Intergenic
1133192503 16:4144838-4144860 AGCCATTTTCAAAGGTGAAGAGG + Intergenic
1135953752 16:26938724-26938746 GGCCAATCCCAAAGGATATGAGG + Intergenic
1137704530 16:50525404-50525426 AGCCATTCTCACAGGAGAATGGG - Intergenic
1141823814 16:86465317-86465339 AGTCATTCTCAAAGGAGGAGGGG + Intergenic
1142815416 17:2421240-2421262 GGCTACTCTGAAAGCAGAGGAGG + Intronic
1146307095 17:31738694-31738716 GGCCAATCTCAATGAAGAAAAGG - Intergenic
1146839677 17:36141971-36141993 GGACACTGGCAAAGGTGAAGTGG + Intergenic
1149402783 17:56315700-56315722 GGCTACTTTCTAAGGAGTAGAGG - Intronic
1150608221 17:66712603-66712625 GGACAGTCTTTAAGGAGAAGGGG - Intronic
1151305576 17:73260977-73260999 GCCGACTCTGGAAGGAGAAGAGG + Exonic
1154961303 18:21311803-21311825 GGCCACTCTCAATGGCAGAGAGG + Intronic
1157322854 18:46647426-46647448 GACCACCATCAAAGGAGAAAAGG + Intronic
1159437375 18:68436435-68436457 GGCCACACACTAAGGAGAAAGGG + Intergenic
1159775634 18:72600702-72600724 GGGCAGTCACATAGGAGAAGGGG + Intronic
1159782158 18:72672830-72672852 GGCCAATCTTAAAGCAAAAGCGG + Intergenic
1161369471 19:3902486-3902508 GGCCACTCCCAGAAGAGACGGGG + Exonic
1162534777 19:11256374-11256396 GGCCTCTCTCCAAGGCCAAGGGG - Intronic
1163515463 19:17760482-17760504 TGCCACTCTCAATGGAAAATTGG - Intronic
1164109720 19:22144713-22144735 GGCCACACTGAAAAGAGAAAGGG + Intergenic
1164194694 19:22945884-22945906 GGCCACACTGAAAAGAGAAAGGG + Intergenic
1165371114 19:35406799-35406821 GGCTACTCTCCAAGGAGGAGAGG + Intergenic
1167409290 19:49335597-49335619 GGCAACTCACGAAGAAGAAGAGG - Exonic
925450460 2:3965054-3965076 CCCCACTCTCAATGGAGAAAAGG - Intergenic
926811592 2:16759621-16759643 GGCTACTCTCAGATCAGAAGAGG + Intergenic
930428896 2:51248865-51248887 AGCCACTCTCAAAATAGATGTGG + Intergenic
932423462 2:71614564-71614586 GGCAAGTCTCACAGGAGAAGAGG - Intronic
933585327 2:84173902-84173924 GGCCCCTGACACAGGAGAAGAGG + Intergenic
933592807 2:84251398-84251420 AGTCACTTTCAAGGGAGAAGGGG + Intergenic
942262597 2:174184168-174184190 GGCCACTCTTAAAGCAGAGGAGG - Intronic
942913730 2:181277538-181277560 GACCCTTCTCGAAGGAGAAGTGG + Intergenic
948388696 2:237597378-237597400 GGCCACTCTAAAGGGCGAAATGG - Intronic
1173615881 20:44402704-44402726 GGCCAGCCTCAGAGGAGAGGGGG + Intronic
1173872236 20:46349299-46349321 GGCCTCTCTCAAATGAGGAAGGG - Intronic
1174587189 20:51618431-51618453 AGCCACTGGCAAAGGAGTAGAGG + Intronic
1175689876 20:61057526-61057548 GCCCTCTCTCACTGGAGAAGCGG - Intergenic
1177114267 21:17066550-17066572 GGCTACTCTTAAAGGAGTGGTGG + Intergenic
1177175868 21:17700193-17700215 GGCCACTGCCAATGGAGAAGAGG + Intergenic
1178455097 21:32741785-32741807 GGCAACCCTCAAGGGAGAACAGG + Intronic
1178822027 21:35984069-35984091 GGCCAGTCCCAAAGAAGAAAAGG - Intronic
1179805088 21:43832350-43832372 GGACACTCTCTTCGGAGAAGGGG - Intergenic
1179816934 21:43912296-43912318 GGCCACGATAAAAGGAGACGTGG - Intronic
1180160513 21:45996989-45997011 GGCCACTCTGATAGGAGAAGGGG + Intronic
1181309530 22:21937155-21937177 GGCCACACCCAAAGGACATGGGG + Intronic
1182205237 22:28617618-28617640 GGCCAAGCCCAAAGCAGAAGAGG - Intronic
1182900613 22:33895253-33895275 GCCCACTCACAGAGGACAAGAGG + Intronic
951207294 3:19938164-19938186 GCCAACTCTGAAAGGAGAAAGGG + Intronic
951465750 3:22998783-22998805 GGACACTGTGAAAGGAGAGGAGG - Intergenic
954760216 3:52868366-52868388 GGCCACTTTTTAAGGAGAAATGG + Intronic
954989963 3:54832146-54832168 AGCCATTCACAAAGGAGAATAGG + Intronic
959187249 3:103060036-103060058 GGCCATTCAGAAAGAAGAAGTGG + Intergenic
962110698 3:132443686-132443708 AGCCACTCTAAAAAGAGGAGCGG + Intronic
963390720 3:144660325-144660347 AGTCACCCTCAAAGGAGAAAAGG + Intergenic
966921180 3:184612599-184612621 GGGCACTCTCTAAGGAGAACTGG - Intronic
968945721 4:3662641-3662663 GGCCCCTTTCACAGCAGAAGAGG + Intergenic
969516549 4:7651421-7651443 GGCCACTCTGGAGAGAGAAGAGG + Intronic
970676340 4:18454653-18454675 GGTAACTCCCAAGGGAGAAGAGG - Intergenic
971419820 4:26465038-26465060 GCCCACTTTCAAAGAAGGAGAGG + Intergenic
972177201 4:36422724-36422746 GGCCACTCACACAGCTGAAGCGG - Intergenic
974285863 4:59866403-59866425 GGCAACTCAAAAAGGAGAGGAGG + Intergenic
975684813 4:76909221-76909243 AGCCAGACTCAAGGGAGAAGGGG - Intergenic
981240705 4:142473525-142473547 GGCAACTCTCAAAGTGCAAGGGG + Intronic
984734402 4:183097666-183097688 GGCCAATCTCGAAGGTGGAGAGG - Intergenic
986558110 5:9032217-9032239 GGCCTTTCTCAAAAGAAAAGAGG - Intergenic
989183750 5:38603225-38603247 GGCAAGTTTCAAAGTAGAAGTGG - Intronic
992950166 5:81850781-81850803 CGGCACTCCCAAAGGAGAATGGG + Intergenic
994134070 5:96264628-96264650 GGACCCTCTCATGGGAGAAGGGG + Intergenic
994906573 5:105846651-105846673 GGCCATTCTCATTGGAGCAGGGG + Intergenic
995027105 5:107436736-107436758 AGCCACTGTCCAAGGAGAACAGG + Intronic
998903284 5:146878137-146878159 AGCCAGTCTCACAGGAGAGGGGG + Exonic
1000884000 5:166730116-166730138 GGAAAGTCTCAAAGGAGATGAGG - Intergenic
1001080786 5:168665726-168665748 GGCCACCCAGGAAGGAGAAGAGG + Intronic
1004208129 6:13611908-13611930 GGCCACACGCAGAGGAGAAATGG + Exonic
1004553844 6:16675933-16675955 AGACACTGCCAAAGGAGAAGCGG + Intronic
1004750563 6:18557874-18557896 AGACACTGTGAAAGGAGAAGGGG - Intergenic
1004789782 6:19012033-19012055 AGCCTCTCTGAAAGGAGAGGAGG + Intergenic
1005287366 6:24342455-24342477 TGCCACACTCCACGGAGAAGTGG - Intronic
1005687905 6:28272714-28272736 GGCCCCTCTGAAAGGAGTACAGG + Exonic
1006140843 6:31928748-31928770 TGCCATTCTCAAAGGAGACAGGG - Exonic
1007430763 6:41775440-41775462 GGCCACTCTCAAAGGAGAAGAGG + Exonic
1007739185 6:44000714-44000736 GGCTGCAGTCAAAGGAGAAGGGG + Intronic
1009820962 6:68800561-68800583 GGTCACTAGCAAAGGAGAAGGGG + Intronic
1009927169 6:70133999-70134021 TGCCAATATCAAAGGGGAAGGGG - Intronic
1012235606 6:96811017-96811039 TGCCACTCTCTATGGAAAAGAGG + Intronic
1014180482 6:118378641-118378663 GGCCATTCTTAAATGAGAACAGG - Intergenic
1015095034 6:129405910-129405932 GGCTAGACTCAAAGGAGTAGAGG - Intronic
1018755051 6:166841780-166841802 GACCACTCTCTAAAGAGATGAGG + Intronic
1019284739 7:217848-217870 GGCCACCCTCAGAGGAAGAGGGG + Intronic
1020201234 7:6081585-6081607 GCCCAGTCGGAAAGGAGAAGGGG - Intergenic
1020934137 7:14439173-14439195 GGCCACTGTCAAATGTAAAGGGG - Intronic
1022519748 7:30998479-30998501 GGCCATCCTCAGAGGAGAAAGGG - Intergenic
1023095882 7:36659369-36659391 GGCCACTCTGCAAGGAGTTGAGG - Intronic
1024180331 7:46886598-46886620 AGCCACACACAAAGGAGAGGAGG + Intergenic
1024973018 7:55087863-55087885 TGCAACTCCAAAAGGAGAAGAGG - Intronic
1030104892 7:105978835-105978857 AGCTACTCCCCAAGGAGAAGAGG + Intronic
1035852460 8:2933981-2934003 TGCCAGTCCCACAGGAGAAGAGG + Intergenic
1036821490 8:11943209-11943231 AGCCACTGTCAATGGACAAGAGG + Intergenic
1038310541 8:26443113-26443135 GTCCACACTGAAAGGAGAAAGGG + Intronic
1040513672 8:48117300-48117322 GGACATTCTCTAAGGAGCAGTGG - Intergenic
1043514131 8:80980434-80980456 CCCCACTCTCACAGAAGAAGAGG - Exonic
1044034760 8:87286990-87287012 AGCCACTCACACAGGAGAAAAGG + Intronic
1049187315 8:141263951-141263973 GGCCACTCTGAAAGGAAAGCTGG + Intronic
1050087783 9:1984543-1984565 GGCCACAGTGAAAGGAGAATTGG + Intergenic
1050406348 9:5312377-5312399 GGCAGCTGTCAAAAGAGAAGTGG + Intergenic
1055136269 9:72832430-72832452 GGCCAATCTGAAAGGAGGAGAGG - Intronic
1055237871 9:74146237-74146259 GGCAACTCTGAAAAGAGAAGTGG + Intergenic
1058161463 9:101574552-101574574 GGACAATCTGGAAGGAGAAGGGG + Intronic
1058900660 9:109439550-109439572 GGCCAATCTCAGAAGGGAAGTGG + Intronic
1058912266 9:109532186-109532208 GGCCACTCTCAAAAGACAAATGG + Intergenic
1059999456 9:119944974-119944996 GGCCAAGTTCAGAGGAGAAGTGG - Intergenic
1061584060 9:131555017-131555039 GGCCACTCACCACGGGGAAGGGG - Intergenic
1203759105 EBV:2806-2828 CGCCACGCTCAAGGGAGGAGAGG + Intergenic
1187560977 X:20403425-20403447 TGGCAGTCTCAAAGGAGGAGAGG - Intergenic
1191180064 X:57552786-57552808 AGCCCCTCCCAAAGGAGAATGGG - Intergenic
1192232727 X:69277270-69277292 GGCCACAGTGTAAGGAGAAGAGG + Intergenic
1196520803 X:116668473-116668495 GGCCACTCTGAAAGCAGCAGAGG + Intergenic
1199679427 X:150215080-150215102 GGCCACTCTCTAAAGAGAACAGG - Intergenic
1199695800 X:150341969-150341991 GGCCACTCTCTAAAGAGAACAGG + Intergenic
1199864871 X:151835147-151835169 GGCCACTCTAAAAGGTATAGTGG - Intergenic
1201921073 Y:19233631-19233653 GGCCACTCTGCAAGCAGCAGAGG + Intergenic