ID: 1007430765

View in Genome Browser
Species Human (GRCh38)
Location 6:41775444-41775466
Sequence ACTCTCAAAGGAGAAGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007430761_1007430765 -3 Left 1007430761 6:41775424-41775446 CCTGTCTGACATCGGCGGCCACT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430759_1007430765 2 Left 1007430759 6:41775419-41775441 CCTGGCCTGTCTGACATCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430754_1007430765 30 Left 1007430754 6:41775391-41775413 CCAGGGTGGAGCAGGGCCTGGTA 0: 1
1: 0
2: 4
3: 30
4: 331
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430758_1007430765 3 Left 1007430758 6:41775418-41775440 CCCTGGCCTGTCTGACATCGGCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275
1007430756_1007430765 14 Left 1007430756 6:41775407-41775429 CCTGGTACTCACCCTGGCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG 0: 1
1: 0
2: 3
3: 30
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007430765 Original CRISPR ACTCTCAAAGGAGAAGAGGT TGG Exonic
902828395 1:18993641-18993663 ACTGTCAGATGAAAAGAGGTGGG + Intergenic
904188484 1:28724676-28724698 AGTCTCAAAAAAAAAGAGGTTGG - Intergenic
904584325 1:31571338-31571360 GCTCTCCCAGGAGAAGAGCTTGG - Intergenic
905934635 1:41813715-41813737 ACCATTAAAGGAGAAGAGCTGGG + Intronic
907457308 1:54583943-54583965 ACTCTCCAAGCAGAAGAGGTGGG - Intronic
908121895 1:60993736-60993758 AGACTAAAAGGAAAAGAGGTGGG + Intronic
908732448 1:67240066-67240088 GGTCTCAAAGGAGAAAGGGTGGG - Intronic
908782164 1:67700550-67700572 ACTCTCAGTGGAGGAGAGTTGGG - Intergenic
909467768 1:75992491-75992513 ACTCTCTAAGGAGAAGTGGAAGG - Intergenic
909655539 1:78027872-78027894 ACTCCAAATGGAGGAGAGGTGGG - Intronic
910394009 1:86773910-86773932 AATCTGAAAGGAGAAGATCTCGG - Intergenic
912158968 1:106957466-106957488 GAGCTCAAAGGAGAGGAGGTAGG + Intergenic
912809167 1:112780838-112780860 AGTCTCCAAGCAGCAGAGGTAGG - Intergenic
913389879 1:118298648-118298670 AGGCTGAAAGAAGAAGAGGTGGG + Intergenic
914432660 1:147632927-147632949 ACAATCACTGGAGAAGAGGTAGG + Intronic
915493376 1:156264309-156264331 ACTTGCAAAGTAGAAGAGGTAGG - Intronic
917710981 1:177684786-177684808 ACTCTCCGAAGAGAAGAGGTTGG - Intergenic
918544809 1:185670412-185670434 ATTTTCAAATGAGAAGAGCTAGG - Intergenic
919451628 1:197778831-197778853 ACTTCCAAACTAGAAGAGGTGGG - Intergenic
919488318 1:198171805-198171827 CCAGGCAAAGGAGAAGAGGTGGG - Intronic
920260230 1:204684135-204684157 ACTGTCATAGGGGAAGATGTAGG - Intronic
920777176 1:208951193-208951215 ACTCTCATAGAAAAAGAGGAGGG + Intergenic
920994409 1:210974861-210974883 ACTCTTAAAGTAGAGGAGGAAGG - Intronic
922036302 1:221851880-221851902 ACTGTCAGAGGGGATGAGGTAGG - Intergenic
922916465 1:229261829-229261851 ACTTTCAAATGAGAAGATGAAGG + Intergenic
923094509 1:230763925-230763947 ACTCACCAAGGGGCAGAGGTGGG - Intronic
1062871536 10:908897-908919 TCCCCCAAAGGAGGAGAGGTGGG - Intronic
1063602299 10:7493421-7493443 TCTCTTAAAGGACAAGAGCTGGG - Intergenic
1063629856 10:7723276-7723298 ACCCTCAGAGGAGAGGAGGTGGG + Intronic
1064288597 10:14013586-14013608 ACCCTGCAAGGACAAGAGGTGGG + Intronic
1064685280 10:17855057-17855079 AATCTCAAAGGAAAAGAGAGGGG + Intronic
1065138604 10:22698306-22698328 ACCCTGAAAGCAGAAGATGTGGG + Intronic
1069633698 10:69912848-69912870 ACTCCCACAGGAGCAGAGCTTGG + Intronic
1073212398 10:101815760-101815782 ACTCTCAAAAGAGCCAAGGTAGG - Intronic
1074068296 10:110039178-110039200 ACTCTGGAAGGAGAAGAGTTAGG - Intronic
1075360009 10:121822988-121823010 ACTTAAAAATGAGAAGAGGTCGG + Intronic
1076203109 10:128573474-128573496 ACTCCCTCAGGAGAAGAGGCTGG + Intergenic
1076507404 10:130987246-130987268 CCTCTCAGAGCAGAAGAGGGTGG - Intergenic
1076677284 10:132153639-132153661 CCTCCCTAAGGAGAAGAGGAAGG + Intronic
1077394628 11:2315017-2315039 GCACTCAGAGGAGAAGAAGTAGG + Intronic
1077898265 11:6470334-6470356 ACTCTCAAAGAAGAGCAGTTTGG + Intronic
1078079301 11:8192517-8192539 ACTGTCTAAGGTGGAGAGGTGGG + Intergenic
1078419916 11:11201872-11201894 ACCCTGTAAGGAGCAGAGGTTGG - Intergenic
1081344356 11:41964729-41964751 ATTCTCTAAGGAAAAGAGGATGG - Intergenic
1081675754 11:44968074-44968096 ACTCTCTGAGGAGAAGGGCTGGG - Intergenic
1081887624 11:46512505-46512527 AGTCCCAAAGGACAAGAGCTTGG + Intronic
1082741011 11:56911175-56911197 AATCTCCAAGGAGAAAAAGTGGG - Intergenic
1084080497 11:66820729-66820751 ACTCCCAAAGGAGAGGAGAAAGG - Intronic
1084122269 11:67076617-67076639 GCTCTCAAAGAAGGAGAGGAGGG - Intergenic
1085324528 11:75596443-75596465 ACTCTCTAAGGAGATGCAGTTGG - Intronic
1087892497 11:103551267-103551289 ATTGTCAAAGGAGATGAGGCAGG + Intergenic
1090088324 11:123671216-123671238 ATTCACAGAGGAGATGAGGTTGG - Intergenic
1090360547 11:126169640-126169662 ACTCCCTAAGGACAAGAGGATGG + Intergenic
1091608304 12:1978043-1978065 ACTCTCAAGAGAGAAGTGGAAGG + Intronic
1094460633 12:30694340-30694362 ACTGCCAATGGAGAGGAGGTTGG - Intronic
1095874348 12:47064050-47064072 TTTCTCAAAGGAGAAGGGTTGGG + Intergenic
1095979938 12:47966500-47966522 CCTCTCAAAAGGGAAGAGGTTGG + Intronic
1096227052 12:49872668-49872690 ACCGTCAAAGGTGAGGAGGTGGG + Intronic
1096309681 12:50509647-50509669 ACTTTTAATGGGGAAGAGGTGGG + Intronic
1097349504 12:58533034-58533056 AATCTCAAGGGAGAAAATGTTGG - Intergenic
1098493609 12:71110318-71110340 ACTGTGAAAGGAGAGGAGTTTGG - Intronic
1099738572 12:86601494-86601516 GCTCTCAAAGGAGATGAGACCGG - Intronic
1100018156 12:90037109-90037131 ACTTACAAAGGAGAGGAGATAGG + Intergenic
1101008703 12:100427847-100427869 ACATTCAGAGGAGAAGAGATTGG + Intergenic
1101683550 12:106993540-106993562 ACTATTATAGGAGAATAGGTTGG + Intronic
1102407670 12:112687740-112687762 TCACTCAGAGGTGAAGAGGTTGG - Intronic
1102596868 12:113999524-113999546 AGTGTCAAAGGAGATGAGGGGGG + Intergenic
1102722008 12:115024463-115024485 ACGCTCGAAGGAGAAAGGGTGGG - Intergenic
1102777689 12:115534878-115534900 CCTCTGAAAGGAGAAGGGGAAGG + Intergenic
1104291744 12:127475575-127475597 ACTCAGAAAGGAGCTGAGGTGGG - Intergenic
1104673711 12:130698178-130698200 ACTTTCAAGGGAGAAGGCGTGGG + Intronic
1106927112 13:34624365-34624387 ACACTAAAAGGAGAAGAAGACGG + Intergenic
1107660606 13:42635474-42635496 ACTCTCAATGCACAAGAGCTTGG + Intergenic
1109406893 13:61912188-61912210 ATAGTCAAAAGAGAAGAGGTAGG - Intergenic
1109828147 13:67750661-67750683 ACGCTTGCAGGAGAAGAGGTAGG + Intergenic
1109918178 13:69019074-69019096 AGTCTCAAAGAAGAAGAATTTGG + Intergenic
1110191251 13:72731423-72731445 ACTCTCAAGTGAAGAGAGGTAGG + Intronic
1110721384 13:78766186-78766208 ACTCTCAGAGGGGAGGAGGTGGG + Intergenic
1111047491 13:82833693-82833715 AGTCTTAAAGGAGAAAAGCTTGG + Intergenic
1111930220 13:94504906-94504928 ACAGTCCAATGAGAAGAGGTAGG - Intergenic
1112189500 13:97162438-97162460 CCTCTCATAGGTGGAGAGGTGGG + Intergenic
1113005228 13:105694388-105694410 TGTCTCAGAGGAGAAGAGGGAGG - Intergenic
1113013291 13:105795673-105795695 ACTTTCAAGGGAGAAAAGGAAGG + Intergenic
1113576462 13:111398501-111398523 AGTCTGAAAGCACAAGAGGTGGG + Intergenic
1115749044 14:36469801-36469823 ACTCACAAAGGAGCAAAGCTGGG + Intergenic
1115751774 14:36500626-36500648 ATTCTATAAGGAGTAGAGGTGGG - Intronic
1117450720 14:55846785-55846807 ACTCCCTAAGGAGATGTGGTCGG + Intergenic
1118849974 14:69575702-69575724 ACTCAAAATGGAAAAGAGGTGGG - Intergenic
1118896030 14:69946392-69946414 ACTCTGCAAGGAGAATGGGTAGG + Intronic
1118992083 14:70806765-70806787 AATGTCAAAGCAGAAGAGCTAGG - Intronic
1119877436 14:78072881-78072903 ACTCTCCAACTAGAACAGGTAGG - Intergenic
1120717937 14:87860205-87860227 CCTCTAAAAGGTGATGAGGTAGG + Intronic
1122551372 14:102551960-102551982 CCTCTCCTAGGAGAAGAGGCAGG + Intergenic
1122733878 14:103823420-103823442 ATTCTCAAAGGAGAAGGGGAGGG + Intronic
1124201964 15:27686438-27686460 ACCATCAAAGGAGAAGAGACTGG + Intergenic
1126439451 15:48671960-48671982 AATCTGAAAGGAGAAGATTTAGG + Intergenic
1127200735 15:56647221-56647243 AGTGTCAATGGAGAAAAGGTTGG + Intronic
1127475432 15:59328095-59328117 CCTCTCAAAGGAGATGGGGCTGG + Intronic
1128298684 15:66548419-66548441 ACCCTCAAAGCAGAAAAGGGAGG + Exonic
1128742585 15:70094405-70094427 ACTCTTCAAGGAGAAGGGGGAGG + Intronic
1130739720 15:86586128-86586150 AGTCAGAAAGGAGAAGAGGAAGG + Intronic
1133192505 16:4144842-4144864 ATTTTCAAAGGTGAAGAGGAAGG + Intergenic
1133737721 16:8628654-8628676 ATTCTCAAAGAAGAAGAGGAAGG + Intronic
1135633366 16:24053672-24053694 ACTTTCAAAGGAGATGAAGGAGG + Intronic
1135738937 16:24956901-24956923 CTTCTCAAAGGAAATGAGGTTGG + Intronic
1136063792 16:27745318-27745340 ACCCACAGAGAAGAAGAGGTAGG - Intronic
1138207109 16:55133216-55133238 ACTCTCACAGGAGGAGAGCAGGG - Intergenic
1140144290 16:72290367-72290389 ACACCTAAAGGACAAGAGGTGGG - Intergenic
1140451825 16:75077081-75077103 ACTCTTAAAGGAGAGTAGCTGGG - Intronic
1141001600 16:80313348-80313370 ACTCAAAAAGGAGCAGAGGCTGG + Intergenic
1141069647 16:80942109-80942131 ACTCTATAAAAAGAAGAGGTTGG - Intergenic
1141358175 16:83369377-83369399 ACTCTGAAAGGAGGAGAGACAGG - Intronic
1141518098 16:84559741-84559763 AGTCTGAAAGGGGAGGAGGTGGG - Intergenic
1142815418 17:2421244-2421266 ACTCTGAAAGCAGAGGAGGGAGG + Intronic
1143485600 17:7251996-7252018 AGTGTCAAAGGGGAAGAGGAGGG - Exonic
1144084530 17:11797145-11797167 AATCTCACAGGAAAAGATGTTGG + Intronic
1144395966 17:14843542-14843564 ACACGCAAAGGAGAAAATGTTGG - Intergenic
1146069150 17:29663399-29663421 AGACTCAATGGAGAAGAGATAGG + Intronic
1149121608 17:53173768-53173790 AATCTCAAAGCAGAATAGGTGGG + Intergenic
1149744163 17:59078237-59078259 TCTTTCTAAGGATAAGAGGTGGG - Intronic
1150624050 17:66830131-66830153 ACTCTCAATGAGGAAGAGATAGG + Intergenic
1150657789 17:67051618-67051640 ACACTTAATGGAGAAGAGGGAGG + Intronic
1150680508 17:67280528-67280550 ATTTGCCAAGGAGAAGAGGTTGG + Intergenic
1150842612 17:68622914-68622936 ACTCACAAATGAGAACAGTTTGG - Intergenic
1150984058 17:70175434-70175456 GGTCTCAATGGAGAAGAGGAAGG - Exonic
1156349529 18:36291458-36291480 ACTCTAAAAGGGGAAGAGGAAGG - Intergenic
1157175601 18:45449312-45449334 ATTCTCATAGGTGAAGAAGTGGG - Intronic
1158017089 18:52796915-52796937 TTTCCCAAAGGAGAAGAGATGGG - Intronic
1158794421 18:60826001-60826023 ACTCTCAAAGGAGAATAACAAGG + Intergenic
1159565791 18:70047025-70047047 ACTCTCACAGGCAAAGAAGTGGG + Intronic
1161594623 19:5144763-5144785 ACTCTGCAGGGAGAAGAGGTGGG - Exonic
1161844138 19:6702210-6702232 ATTCTGGATGGAGAAGAGGTTGG + Exonic
1164795605 19:31025108-31025130 ACTCTCGAAGGAGAAGAAAGTGG - Intergenic
1165007715 19:32820072-32820094 TCTATCGAAGGAGAAGAGGGTGG + Intronic
1165357315 19:35312118-35312140 CCTCTCACAGGAGGAGAGGAAGG + Intronic
1166707975 19:44919072-44919094 ATTCTGCAAGGGGAAGAGGTGGG + Intronic
925273977 2:2636123-2636145 ACTCTCCACGTGGAAGAGGTGGG - Intergenic
925979659 2:9166601-9166623 ACTTTCAAATGAGAAAATGTGGG + Intergenic
926137596 2:10347512-10347534 ACTTCCAAAGGAGAAGTAGTGGG - Intronic
926188060 2:10707148-10707170 GCTCACAAAGGAGAAGAGTGTGG + Intergenic
928286598 2:29995449-29995471 ACATGCAAAGGAGAAGAGATGGG + Intergenic
930923400 2:56785911-56785933 ACTCTCAATGAACAAGAGGAAGG - Intergenic
931419085 2:62109406-62109428 AGACTCAAAAGAGAAGAGATGGG - Intronic
932260574 2:70323479-70323501 TCTCTTAATGGAGAAGGGGTTGG + Intergenic
933918690 2:87022796-87022818 ACTGGCAAAAGAGTAGAGGTGGG + Intergenic
934004305 2:87747119-87747141 ACTGGCAAAAGAGTAGAGGTGGG - Intergenic
934846311 2:97663525-97663547 ACTCTCAACTGAGAAGAGTCCGG + Intronic
934970089 2:98756202-98756224 ACTCTGAAAGGAGCAGATGTAGG + Intergenic
935739983 2:106138816-106138838 ATTCTCAAAGGAGAGGGGGGTGG - Intronic
935767265 2:106381133-106381155 ACTGGCAAAAGAGTAGAGGTGGG - Intergenic
938188023 2:129250725-129250747 AGTCTAATAGGATAAGAGGTAGG + Intergenic
941271128 2:163430409-163430431 ACTGGAAAAGGAGGAGAGGTGGG - Intergenic
941483556 2:166048997-166049019 ACACTCAAATGAGAACAGGAAGG + Intronic
941627063 2:167841636-167841658 ACTCTCTTAGGAGAAGGGGGAGG - Intergenic
943380833 2:187144662-187144684 ATTCTAGAAGGAGCAGAGGTGGG + Intergenic
944877642 2:203978477-203978499 AGTCTCAAAGCTGAAGAAGTTGG + Intergenic
946327458 2:218992243-218992265 ACTGGAAAAGGAGAAGAGCTGGG + Exonic
946456644 2:219832040-219832062 AGTCTCCAAGGTGATGAGGTGGG - Intergenic
946783824 2:223221301-223221323 CATTTCAAAGGAGGAGAGGTTGG + Intergenic
1169019131 20:2315585-2315607 GCACTCCAAGGAGAAGGGGTAGG + Intronic
1172104734 20:32510185-32510207 ACGCTCAGATGAGAAGACGTGGG + Intronic
1173297966 20:41776206-41776228 ACTCTGAAAGGAGAGTAGGCAGG - Intergenic
1173818124 20:46003116-46003138 GCTCACAATGGGGAAGAGGTGGG - Intergenic
1175901345 20:62361042-62361064 TTTCTCAAAGGAGGAGAGGCGGG + Intronic
1178497617 21:33100821-33100843 ACTGTCAAAAGAGATGAGATGGG + Intergenic
1180160515 21:45996993-45997015 ACTCTGATAGGAGAAGGGGCAGG + Intronic
1182864093 22:33586821-33586843 ACTGTGAAAGGAGCAGAGGGAGG - Intronic
1183269240 22:36850332-36850354 AGTCACAGAGGAGAAGCGGTGGG + Intergenic
1183503347 22:38194440-38194462 ATTCTGGAAGGAGGAGAGGTAGG + Intronic
1185207611 22:49549076-49549098 AATCTCAGAGGAGGAGAGGTCGG + Intronic
949117403 3:343782-343804 AATCTCAAAGGAAATGATGTTGG - Intronic
951651707 3:24958162-24958184 ACTCTCAAAGGATAACAGGGAGG + Intergenic
952391775 3:32886621-32886643 ACTCAGAAAGGAGGAGAGTTAGG + Intronic
952410347 3:33043461-33043483 ACTTCCAAAGTAGAAGAGGGGGG + Intronic
955947805 3:64212078-64212100 GCCCTCAAAGGAGAAGAGCTTGG + Intronic
956022817 3:64950307-64950329 AGTCTACAAGGAAAAGAGGTGGG + Intergenic
956409421 3:68964215-68964237 ACACTCAGGGGAGAAGAGATGGG + Intergenic
957363891 3:79196649-79196671 AGCCTCATAGGAGAAGAGTTTGG + Intronic
959969701 3:112395533-112395555 ACTCTCACTGGAGAAAAGGAAGG + Intergenic
960400513 3:117191958-117191980 ACTCTAAAAAGAGGAGTGGTAGG + Intergenic
961422044 3:126814138-126814160 AGTCAGAAAGGAGTAGAGGTAGG + Intronic
963261829 3:143200414-143200436 GCTCTCAATGGGGAGGAGGTGGG + Intergenic
963287627 3:143450644-143450666 ATTCTCAAAGGAAAGGAGGATGG - Intronic
965790139 3:172378751-172378773 ACTTTCAGAGAAGCAGAGGTTGG + Intronic
967333585 3:188317854-188317876 AGTCTCAATGGAGAAGAGGTGGG + Intronic
967749106 3:193093664-193093686 ATTGTCTAAGGAGAAGTGGTGGG - Intergenic
968122588 3:196136117-196136139 ACTCTCAAAGCTGGAGAGCTGGG - Intergenic
968945726 4:3662645-3662667 CCTTTCACAGCAGAAGAGGTGGG + Intergenic
969101386 4:4771408-4771430 ACTTTGAAAGGAGAAGAGTGTGG + Intergenic
971417076 4:26441723-26441745 ACTCTCCAAGATGCAGAGGTTGG - Intergenic
971419823 4:26465042-26465064 ACTTTCAAAGAAGGAGAGGAAGG + Intergenic
971702883 4:30002972-30002994 ACTCTTTTAGGAGAAGAGCTTGG - Intergenic
971828167 4:31654891-31654913 AGTGTCAAAGGAGAGAAGGTGGG + Intergenic
972696675 4:41453169-41453191 ACTGACAAAGATGAAGAGGTTGG - Intronic
974300607 4:60061543-60061565 GGTCTCAAGGGAGAAGAGGTAGG + Intergenic
974578660 4:63764937-63764959 ACTCTCTAAAGAGAAGATTTGGG + Intergenic
975345069 4:73283928-73283950 ACTTACAAAGGAGAAGGGCTAGG + Intergenic
975436412 4:74357602-74357624 ATTCTCAAAGGAGAAGGAGGTGG - Intergenic
975486973 4:74944542-74944564 ACTCCCATGGGAGAAGAGGTGGG - Intronic
976354994 4:84106643-84106665 ATTCTCAAAGGATCAGAGTTTGG + Intergenic
978279439 4:106992421-106992443 ACTTTCAATGGCCAAGAGGTGGG - Intronic
978493136 4:109330532-109330554 CCTCACATAGTAGAAGAGGTGGG + Intergenic
980023282 4:127734614-127734636 ACTCCTAAAAGAGAAGAGTTTGG - Intronic
981800957 4:148654924-148654946 AGTCCCAAAGGAAAGGAGGTTGG + Intergenic
986271287 5:6233098-6233120 AGTCTCACAAGAGAAGAGGGAGG + Intergenic
986487265 5:8250260-8250282 AATTTCAAGGGAGAAGAGGAAGG + Intergenic
986784481 5:11100589-11100611 CCTCTCAAAGGAGACCAGCTTGG + Intronic
987151678 5:15046921-15046943 ACTCCCAAAGGTGAAGAACTTGG - Intergenic
987576337 5:19733461-19733483 GCTCTCAGCGGAGAAGAGATGGG - Intronic
988423009 5:31029509-31029531 ATTCTCAAAAGAGATGAGTTAGG + Intergenic
989036823 5:37182339-37182361 ACTCTCAGGCCAGAAGAGGTTGG - Intronic
992470921 5:77052453-77052475 AGTACCAAAGGAGAAGAGGTAGG + Intronic
992950168 5:81850785-81850807 ACTCCCAAAGGAGAATGGGTGGG + Intergenic
995841992 5:116451262-116451284 AGCCACAAAGGAGAAGTGGTGGG + Intronic
997259424 5:132454600-132454622 ACTCTCAAAGGCAAAGAGAATGG - Intronic
997389024 5:133498188-133498210 AAGCTCTAAGGAGAAGAGCTTGG - Intronic
997454830 5:134008639-134008661 GCTCTGAAAAGAGAAGAGTTGGG - Intergenic
999010978 5:148040220-148040242 AGTCTCAAAGGAGAATAGTTGGG - Intronic
999417807 5:151415065-151415087 CCTCTCCAAGAAGATGAGGTTGG - Intergenic
999713378 5:154338746-154338768 TGTCTCAAAGAAGAAGAGATGGG - Intronic
1000337695 5:160253796-160253818 ACTCTGAAACGAGAAGACCTGGG + Exonic
1000739539 5:164950680-164950702 GCTATCAAAGGAGAGAAGGTGGG - Intergenic
1000751477 5:165100675-165100697 ACTCGGTAAGGAGTAGAGGTTGG - Intergenic
1001240977 5:170069612-170069634 GCTCTAAAAGGAGGAGAAGTGGG - Intronic
1001931551 5:175676725-175676747 ACTCTGAAGGGTGAGGAGGTGGG - Intronic
1004397696 6:15260517-15260539 AGTCTCATAGTTGAAGAGGTCGG + Intronic
1005276966 6:24229897-24229919 TCTCTCAAAGGGGAAGTGGTGGG - Intronic
1005824478 6:29624507-29624529 GCTCTGAAAAGAGAAGAGGGAGG - Intronic
1006365589 6:33613306-33613328 CCTCTCAGAGGAGAGGAGGAGGG + Intergenic
1007396215 6:41579207-41579229 ACCCTCAAAGGGGAGGAGCTGGG + Intronic
1007430765 6:41775444-41775466 ACTCTCAAAGGAGAAGAGGTTGG + Exonic
1007779863 6:44246575-44246597 ACTCTCGCAGGAGTAGAGGAAGG - Intronic
1010655966 6:78511372-78511394 TCTCTCCAAAGAGAAGAGATTGG + Intergenic
1011174922 6:84549863-84549885 AATCACTAAGGAGAACAGGTGGG - Intergenic
1011693018 6:89887418-89887440 ACACACAAAGGAGGAGATGTAGG + Intergenic
1012068879 6:94586085-94586107 ACTCCAAAAGGAGAAAAGGTGGG + Intergenic
1015170039 6:130242177-130242199 CCTATCAAGGGAGAATAGGTTGG + Intronic
1016628201 6:146197126-146197148 ACTCAGAAACGAGAACAGGTGGG + Intronic
1018099567 6:160424682-160424704 TCTCTCAAAGGTGAATAGGATGG + Intronic
1018128090 6:160701265-160701287 ACTGGCAAAAGAGTAGAGGTGGG - Intergenic
1018148358 6:160915106-160915128 ACTGGCAAAAGAGTAGAGGTGGG + Intergenic
1019091341 6:169537490-169537512 ACTCCCAAAGTGGAAGAGCTTGG + Intronic
1019206215 6:170364224-170364246 AGGCTCAAAGGAGAAGAGGTCGG - Intronic
1019923591 7:4178369-4178391 ACCCTCCAAGGAGAGGAGGCGGG - Intronic
1020503862 7:8958433-8958455 AGGCTGAAAGGATAAGAGGTTGG - Intergenic
1020646982 7:10826266-10826288 ACTCTCATGGGAGATGAGATGGG + Intergenic
1021132015 7:16922789-16922811 GCTCTAATAGGAGAAGTGGTTGG + Intergenic
1022581634 7:31560954-31560976 ACCAGCAAAGGAGAAGAGGTAGG + Intronic
1023350332 7:39313990-39314012 AATCTCAAAGCAGAAGAAGTTGG - Intronic
1024072210 7:45795840-45795862 ACTCCCAGAGGAGAAGGAGTGGG + Intergenic
1026175232 7:67990904-67990926 ACTCACAAAGGGGAGGAGGCTGG - Intergenic
1026595014 7:71727129-71727151 CCACTCAAAGGAGAACAGCTGGG + Intergenic
1027602477 7:80256197-80256219 ACCTTCAAAGTAGAAGAGGAAGG + Intergenic
1027821602 7:83052837-83052859 AATATGAAGGGAGAAGAGGTTGG - Intronic
1028978934 7:96945339-96945361 ACTCTCCAGGGAGAAGACGTAGG + Intergenic
1029001106 7:97155425-97155447 AGTCTAAAAGGATAAGAAGTTGG - Intronic
1030104893 7:105978839-105978861 ACTCCCCAAGGAGAAGAGGCTGG + Intronic
1030303267 7:107995307-107995329 GCTCTCAAAGGAAAAAAGGGAGG + Intronic
1030877971 7:114839125-114839147 ACTCTTCAAAGAAAAGAGGTAGG - Intergenic
1033533344 7:142288185-142288207 TCTCTCAAATGAGAAGCCGTTGG - Intergenic
1033760488 7:144431799-144431821 AATTTAAAAGGTGAAGAGGTAGG + Intergenic
1037017844 8:13930720-13930742 ACTCACAAAGGAAATGAGGAGGG + Intergenic
1037721170 8:21445243-21445265 ATCCTCAAAAGAGAAGTGGTGGG - Intergenic
1038391983 8:27210356-27210378 CTTCCCAAAGAAGAAGAGGTGGG + Intergenic
1040379593 8:46859445-46859467 ACTCTGCAAAGAGAAGGGGTTGG + Intergenic
1042050096 8:64694465-64694487 AGTCTGAAAGGTGCAGAGGTAGG + Intronic
1042088181 8:65131508-65131530 ACTTTCAAGGAAGAAGAGGGGGG - Intergenic
1043558836 8:81466818-81466840 ACTCTGAAAGGAAGAGAGGCAGG - Intergenic
1043678084 8:82986582-82986604 TCTCTCAAAGATGAAGAGCTTGG + Intergenic
1044928304 8:97228097-97228119 ACACTCAAGGGAGAAGAAGGTGG + Intergenic
1045614606 8:103895239-103895261 ACTCTCAGTGGAACAGAGGTTGG - Intronic
1045639859 8:104237361-104237383 ACTCTCAATGGACAAGTAGTGGG - Intronic
1046490008 8:114939649-114939671 ACTTTAAAAGGAAAAGAGGTTGG + Intergenic
1047304436 8:123641591-123641613 AGTCTCAAAGGAGAAGAATAGGG + Intergenic
1047700445 8:127444296-127444318 ACTCACATAAGAGAAGAGGTAGG - Intergenic
1049003589 8:139841215-139841237 CCTTTCAGAGGAGAAGAGGGAGG - Intronic
1050082079 9:1926321-1926343 ATTCTCAAAGGAGGAGCGATTGG + Intergenic
1050221318 9:3393819-3393841 ACTCTAAAAGGAGAGAGGGTGGG + Intronic
1051432537 9:16994705-16994727 GCACTCTAAGGAGAAGAGATTGG - Intergenic
1051796387 9:20876232-20876254 ACTCTGAAAAGCTAAGAGGTAGG - Intronic
1051949882 9:22618942-22618964 ATTTTCAAAGAAGAAGAGCTGGG + Intergenic
1052306443 9:27015335-27015357 ACTTTTAGAAGAGAAGAGGTTGG + Intronic
1055540364 9:77298414-77298436 ACCCTCAAAAGAGACGAAGTAGG + Intronic
1055738774 9:79362720-79362742 AGCCTCAAAGGACAAGAGGATGG + Intergenic
1056058867 9:82861536-82861558 ACTCACAAAGCAGAAGAGAGGGG + Intergenic
1056203986 9:84302868-84302890 AGTCTCTAAGGAAAAGAGGTAGG + Intronic
1056568342 9:87794363-87794385 AATCTAAGAGGAGAAGAGGAGGG + Intergenic
1056813757 9:89784485-89784507 AGTTTGAAAGGAGAAGAGGAGGG + Intergenic
1058474248 9:105315046-105315068 ACTCCCAAAGCAAAAAAGGTGGG - Intronic
1060388016 9:123251226-123251248 TCTCTCAAAGAAGAAGAAGAAGG + Intronic
1061052633 9:128205244-128205266 ACATTCAAAGGACGAGAGGTAGG - Intronic
1062098291 9:134714045-134714067 AGTCTCAAGGGAGAAGACTTGGG - Intronic
1062378113 9:136274067-136274089 CCGCTCAAAGGAGTGGAGGTGGG + Intergenic
1186592834 X:10949800-10949822 TCTCCCAAAGGAGAGGAGCTGGG + Intergenic
1186617792 X:11207835-11207857 ACTGTCAAATGAGCAGAGGACGG - Intronic
1188172348 X:26943202-26943224 ACTCTGAAAGTAGAACAAGTAGG + Intergenic
1189566677 X:42248982-42249004 ACTCTCAAAAGAGATGATGAGGG - Intergenic
1191044442 X:56120733-56120755 AGCCTCAAAGGGGAGGAGGTGGG - Intergenic
1192003318 X:67180798-67180820 TCTCTCATAGTAGATGAGGTGGG - Intergenic
1193311801 X:80019011-80019033 ATTGAAAAAGGAGAAGAGGTAGG + Intronic
1195160692 X:102167853-102167875 TCTGTGAAAGGAGAAGAGGAAGG - Intergenic
1195992820 X:110699567-110699589 AATCTTAAAGGAGTAGAAGTGGG - Intronic
1197922224 X:131607524-131607546 ACAATCAAAAGAGAAGACGTTGG + Intergenic
1197931796 X:131703932-131703954 AGTCTCAAAGGAAAATAGGGTGG + Intergenic
1199021764 X:142887350-142887372 ACTCTAAAAGCAGAAAAGGATGG + Intergenic
1202169668 Y:22029465-22029487 AATCTCAAAATAAAAGAGGTAGG - Intergenic
1202221698 Y:22556908-22556930 AATCTCAAAATAAAAGAGGTAGG + Intergenic
1202321420 Y:23638766-23638788 AATCTCAAAATAAAAGAGGTAGG - Intergenic
1202549347 Y:26031290-26031312 AATCTCAAAATAAAAGAGGTAGG + Intergenic