ID: 1007431449

View in Genome Browser
Species Human (GRCh38)
Location 6:41779704-41779726
Sequence CGCCCGCCCGGGGCTTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007431437_1007431449 -1 Left 1007431437 6:41779682-41779704 CCCCGGTGCTCCGCCGCCTGCCC 0: 1
1: 0
2: 1
3: 25
4: 306
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431431_1007431449 10 Left 1007431431 6:41779671-41779693 CCCGCCCCCAGCCCCGGTGCTCC 0: 1
1: 0
2: 13
3: 123
4: 1422
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431434_1007431449 5 Left 1007431434 6:41779676-41779698 CCCCAGCCCCGGTGCTCCGCCGC 0: 1
1: 0
2: 3
3: 20
4: 346
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431428_1007431449 17 Left 1007431428 6:41779664-41779686 CCGGATCCCCGCCCCCAGCCCCG 0: 1
1: 1
2: 21
3: 205
4: 1652
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431433_1007431449 6 Left 1007431433 6:41779675-41779697 CCCCCAGCCCCGGTGCTCCGCCG 0: 1
1: 0
2: 2
3: 18
4: 226
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431439_1007431449 -3 Left 1007431439 6:41779684-41779706 CCGGTGCTCCGCCGCCTGCCCGC 0: 1
1: 0
2: 0
3: 25
4: 334
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431426_1007431449 19 Left 1007431426 6:41779662-41779684 CCCCGGATCCCCGCCCCCAGCCC 0: 1
1: 0
2: 19
3: 127
4: 1197
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431427_1007431449 18 Left 1007431427 6:41779663-41779685 CCCGGATCCCCGCCCCCAGCCCC 0: 1
1: 0
2: 13
3: 254
4: 1710
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431430_1007431449 11 Left 1007431430 6:41779670-41779692 CCCCGCCCCCAGCCCCGGTGCTC 0: 1
1: 0
2: 9
3: 102
4: 1233
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431436_1007431449 3 Left 1007431436 6:41779678-41779700 CCAGCCCCGGTGCTCCGCCGCCT 0: 1
1: 0
2: 0
3: 33
4: 361
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431432_1007431449 9 Left 1007431432 6:41779672-41779694 CCGCCCCCAGCCCCGGTGCTCCG 0: 1
1: 0
2: 2
3: 61
4: 1053
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431438_1007431449 -2 Left 1007431438 6:41779683-41779705 CCCGGTGCTCCGCCGCCTGCCCG 0: 1
1: 0
2: 0
3: 28
4: 237
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1007431435_1007431449 4 Left 1007431435 6:41779677-41779699 CCCAGCCCCGGTGCTCCGCCGCC 0: 1
1: 1
2: 1
3: 24
4: 265
Right 1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007431449 Original CRISPR CGCCCGCCCGGGGCTTCCTA GGG Intronic
903808727 1:26022758-26022780 CCTCGGCCCGGGGCTTCCCAAGG + Exonic
922802609 1:228371237-228371259 TGCACCCCCGGGGCTTCCTGCGG + Exonic
1065342900 10:24723412-24723434 CGCCCGCCGCGGGCTCCCTCCGG + Intronic
1066126586 10:32347622-32347644 CGCCCCCACGGGGCTTCGGAGGG + Intronic
1070828232 10:79403591-79403613 AGGCCACCCGGGGCTTCCTCTGG + Intronic
1075040633 10:119104397-119104419 CGCCCGCCCGCGGCCGCCTGTGG + Intronic
1076156877 10:128211198-128211220 TGCTCGCCCGGGGCTACCTCGGG + Intergenic
1076818160 10:132924724-132924746 CGCCAGCCAGGGGCTTCCGCAGG + Exonic
1077487589 11:2846151-2846173 GGCCCGCCCGGCGCAGCCTAGGG + Intronic
1090086387 11:123654392-123654414 CGCCCGCCCTCGGCTCCCTGGGG + Exonic
1091564602 12:1639380-1639402 CGCCCGCCCCGGCCTCCCAAAGG + Intronic
1091775523 12:3182348-3182370 CGCCCACCCGAGGCTGCCTGGGG + Intronic
1102645496 12:114400980-114401002 CGCCTGCTCGGGGCATCCTCTGG + Intronic
1104987319 12:132604236-132604258 CCCCCGCCCGGGACTTACCAGGG + Exonic
1106559052 13:30833170-30833192 CACCCGCCCAGGGCCACCTAGGG - Intergenic
1109404999 13:61886356-61886378 CGCCCGCCTCGGCCTTCCAAAGG + Intergenic
1113378987 13:109786267-109786289 CGCCCGCGCCGGGCATCCTCAGG - Exonic
1113806189 13:113110967-113110989 CGCCCGCGCGGCGCTTTCTGCGG + Intronic
1113946136 13:114044546-114044568 CGCCCGCCCAGGGCTGCCGGTGG - Intronic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1123168016 14:106344875-106344897 CGCCAGCCCTGGGATTCCCAGGG - Intergenic
1123170655 14:106369588-106369610 CGCCAGCCCTGGGATTCCCAGGG - Intergenic
1123194323 14:106601834-106601856 CGCCAGCCCTGGGATTCCCAGGG - Intergenic
1128455232 15:67828119-67828141 GGCCGGCGCGGGGCCTCCTAGGG - Exonic
1132320297 15:100919947-100919969 CGCTGGTCCGGGGCTTCCTGGGG + Intronic
1132656687 16:1044470-1044492 CACCCGCCCGGGGCCGCCTGGGG + Intergenic
1134482818 16:14633309-14633331 CTCCCTCCTGGGGCTCCCTAGGG + Intronic
1137036837 16:35575280-35575302 CCCCCGCCCCGGACCTCCTAGGG + Intergenic
1147145497 17:38482287-38482309 CGCCTGCCCCGGGCCTCCCAGGG + Intronic
1150758489 17:67937868-67937890 CGCCCGCCTTGGCCTCCCTAAGG - Intronic
1150763055 17:67979794-67979816 CGCCCGCCTCGGCCTTCCAAAGG - Intronic
1151947061 17:77325553-77325575 GGCCAGCCCGGGGCGTCCTGAGG + Intronic
1152561182 17:81079546-81079568 CACCAGCCCAGGGCTGCCTAGGG - Intronic
1160909969 19:1469821-1469843 GGCCCGGCCGGGGCGTCCTCGGG - Exonic
1161232010 19:3179133-3179155 CGCCCGCCCAGTGGTTCCTACGG + Exonic
1162140203 19:8580806-8580828 CGCCCCCCCGGGGCCCCCTCTGG + Exonic
1163509376 19:17726073-17726095 CGACCTCCGGGGGCTTCCTCAGG + Exonic
1165119809 19:33551829-33551851 CCCTCTCCCGGGGCTTCCTAGGG + Intergenic
1166672944 19:44722443-44722465 GGCCCGCTCGGGGCTTCCCGAGG - Intergenic
1166990813 19:46691690-46691712 CCCCAGCCCGGGGCTCCCTCTGG + Intronic
1167972700 19:53198311-53198333 CGCCCGCCTGGGCCTCCCAAAGG + Intergenic
1168459151 19:56539081-56539103 GGCCCGCCCGGGGCTTTGTGCGG - Exonic
925221500 2:2145138-2145160 CACCTGCCAGGAGCTTCCTAAGG - Intronic
929316296 2:40483046-40483068 CGCCCGCCTCGGGCTCCCAAAGG + Intronic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
942973847 2:181990385-181990407 CGCCCGCCTCGGCCTCCCTAAGG + Intronic
948511123 2:238466062-238466084 CGCGCGCCCCGGGCTGCCTGTGG + Intergenic
1176084071 20:63288007-63288029 CGCACACCCGGGTCTCCCTAGGG - Exonic
1176093738 20:63330155-63330177 CGCCTGCCCAGCGCTTCCTGAGG - Intronic
1177548050 21:22584499-22584521 CGCCCGCCCCGGCCTCCCGAAGG + Intergenic
1180638384 22:17278709-17278731 CGCCCGCCTCGGCCTTCCAAAGG + Intergenic
1183614774 22:38937266-38937288 CCCCAGCCCAGGGCTTCCCACGG + Intergenic
1185381114 22:50507899-50507921 CGCCCGCCCGCGGCTGCCCCAGG + Intergenic
953627735 3:44584841-44584863 CGACCGCGCGGGGCTTCTGAGGG + Intronic
954061172 3:48068543-48068565 CGCCCGCCTTGGCCTCCCTAAGG - Intronic
957427026 3:80051801-80051823 GGCCCGCCCGTGGCTGCCCACGG + Intergenic
965827752 3:172747822-172747844 CGCCCGCCTGGGCCTTCCAAAGG + Intergenic
968446503 4:654963-654985 CGTCCTCCCAGGGCTTCCCACGG + Intronic
968728753 4:2260109-2260131 CGCCAGCCCTGGGCTGCCTCAGG + Intronic
975683491 4:76897910-76897932 CGCCCGGCCAGGGTTTCCTCTGG - Exonic
985965514 5:3336430-3336452 CTCCCTCCCCGGGCTCCCTAGGG - Intergenic
986667855 5:10118742-10118764 CGCCCGCCTCGGCCTTCCAAAGG + Intergenic
993900515 5:93581317-93581339 CGCCCGCCTGAGCCTGCCTAGGG + Intergenic
994728510 5:103464406-103464428 CGGCCCACCTGGGCTTCCTATGG - Intergenic
1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG + Intronic
1007740482 6:44006571-44006593 TGCCCGCCTTGGGCTTCCTGGGG - Intergenic
1018278477 6:162158673-162158695 CGCCCGCCTTGGCCTTCCAAAGG + Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1022923257 7:35037179-35037201 CGCCCGCCGGGGGCGGCCTTGGG - Intronic
1023812939 7:43926484-43926506 GGCCCGGCCGGGGCTGCCTGAGG - Exonic
1024801735 7:53087360-53087382 CGCCCTCCCGGGGCTGGCGAAGG - Intergenic
1034528058 7:151678551-151678573 TGCCAGCCCGGGGCTTCCAGAGG - Intronic
1035167423 7:157000008-157000030 GGCCCGGCCGAGGCTTCCTGAGG - Intronic
1039467825 8:37796820-37796842 CGCCCGCCCGGGCCTTCCGCGGG - Intronic
1041200826 8:55451139-55451161 CCCCCGACCCGGGCTTCCTGTGG - Intronic
1049419515 8:142510673-142510695 CCCCCGCCCGGCGCTCCCTCGGG + Intronic
1050807437 9:9698657-9698679 CGCCCTCCCAATGCTTCCTATGG + Intronic
1061332008 9:129900634-129900656 GGCCAGCCCGGAGCATCCTAAGG + Intronic
1061693692 9:132355247-132355269 GCCCCGCCCGGGGCTTCCTGCGG + Intergenic
1062363260 9:136197455-136197477 GGCCCGCCGGGGGCTCCCGAGGG + Exonic
1200235928 X:154467710-154467732 CGCCCACCCTGGGCTGCCCAGGG - Intronic