ID: 1007431525

View in Genome Browser
Species Human (GRCh38)
Location 6:41779914-41779936
Sequence GACCTCCGACCCCGCGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007431525_1007431531 9 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431531 6:41779946-41779968 ACCAACGAGACGCTGCGGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1007431525_1007431534 22 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431534 6:41779959-41779981 TGCGGGCTGGCGGACCCGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 72
1007431525_1007431530 5 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431530 6:41779942-41779964 CAGCACCAACGAGACGCTGCGGG 0: 1
1: 0
2: 2
3: 11
4: 110
1007431525_1007431533 12 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431533 6:41779949-41779971 AACGAGACGCTGCGGGCTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64
1007431525_1007431536 24 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431536 6:41779961-41779983 CGGGCTGGCGGACCCGAGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 138
1007431525_1007431529 4 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431529 6:41779941-41779963 GCAGCACCAACGAGACGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1007431525_1007431535 23 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431535 6:41779960-41779982 GCGGGCTGGCGGACCCGAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1007431525_1007431537 25 Left 1007431525 6:41779914-41779936 CCGCGGCCGCGGGGTCGGAGGTC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1007431537 6:41779962-41779984 GGGCTGGCGGACCCGAGCGGGGG 0: 1
1: 0
2: 1
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007431525 Original CRISPR GACCTCCGACCCCGCGGCCG CGG (reversed) Intronic
900191830 1:1355384-1355406 TGCCCCCGACCCCGCGGCCCCGG + Intronic
900203166 1:1420280-1420302 GTCCTCCGCCTCCGCTGCCGCGG + Exonic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
905389502 1:37627132-37627154 GCCCTCCTACCCTGCAGCCGAGG + Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906480957 1:46198480-46198502 GCCCTCTCACCCCGCGGCAGCGG - Intronic
906640495 1:47438182-47438204 GGCCTCGGACAGCGCGGCCGGGG - Exonic
914510653 1:148329249-148329271 GACCTCTCACCCCGAGGCCCAGG - Intergenic
915453136 1:156020698-156020720 GACCCCCGCCCCCCCGCCCGTGG - Intronic
917869640 1:179229748-179229770 GCCCTCCTTCCCCGCGGCGGAGG - Intergenic
919738999 1:200971433-200971455 GAGCTCCCACCCCCGGGCCGGGG - Intronic
923712796 1:236400400-236400422 AACCTCAGACCCCGCAGCAGGGG - Intronic
1073481166 10:103786957-103786979 GACCTCAGTCCCAGCGGCCAAGG - Intronic
1074818821 10:117164001-117164023 AACCTCTGACCCCCCGCCCGGGG - Intergenic
1077273840 11:1694129-1694151 GAGCTCCGAGCCTGTGGCCGAGG - Intergenic
1077335510 11:2002034-2002056 GACCTGGGGCCACGCGGCCGTGG + Intergenic
1083658772 11:64242446-64242468 GCCCTCGGCCCCCGTGGCCGTGG - Exonic
1083890278 11:65592451-65592473 GATCCCCGACCCCACGGGCGGGG + Exonic
1085332892 11:75668012-75668034 CACCTCCGGCCCCGCGGACTCGG - Exonic
1090327895 11:125904604-125904626 GAGCTCCACCCCCGCGGCTGTGG - Intronic
1202818494 11_KI270721v1_random:57216-57238 GACCTGGGGCCACGCGGCCGTGG + Intergenic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1092100324 12:5877980-5878002 GGTCTCCAACCCCCCGGCCGTGG - Intronic
1094041190 12:26122915-26122937 GGCCGCGGACCCGGCGGCCGAGG + Exonic
1096024806 12:48351096-48351118 GACCTCCGCGCCCGCCGCTGTGG + Intronic
1096495466 12:52037174-52037196 GCCCCCCGCCCCCGCGCCCGCGG - Intronic
1096738617 12:53675861-53675883 GACCTCCAACCGCGCGGGCCTGG - Intronic
1098943043 12:76559451-76559473 GGCCTCGGACCCCGGCGCCGCGG - Exonic
1100844541 12:98645118-98645140 GCCCGCCTACCCCGCGGACGGGG - Intergenic
1101371817 12:104137833-104137855 GAGCTCCGGGCCCGGGGCCGAGG - Intronic
1104624280 12:130338933-130338955 GACCTCCGCCCCCGCACCCCCGG - Intronic
1108373281 13:49792076-49792098 GCCCTCCGACCGCACAGCCGAGG - Intronic
1113771458 13:112911664-112911686 CACCTCCTTCCCCGAGGCCGAGG + Intronic
1113946975 13:114049920-114049942 GGCCTCCGACCCCGCGGCATGGG - Intronic
1115997644 14:39210705-39210727 CACCTCGGACTCCGAGGCCGAGG + Intergenic
1122577215 14:102750030-102750052 GGCCTCGGTCCCCGCGGCCTCGG + Intergenic
1122829729 14:104389825-104389847 GACCCCCTTCCCCGAGGCCGTGG - Intergenic
1122887327 14:104715917-104715939 GTCCTCCCACCCCGAGGCCATGG + Intronic
1124637249 15:31373065-31373087 GACCTCCGAGGCAGGGGCCGGGG + Exonic
1138651453 16:58463674-58463696 GGCCTCCGCCCCTGCAGCCGCGG + Intronic
1142067669 16:88072101-88072123 CTCCTCGGACCCCGCGGCGGCGG + Exonic
1144724848 17:17496620-17496642 GGCCGCCGAGCCCGCGGCAGTGG - Intergenic
1146814365 17:35930640-35930662 GAGCTCCGGACCCACGGCCGAGG - Exonic
1147788607 17:42998513-42998535 GACCTTCGACCCCCAAGCCGCGG - Exonic
1148664106 17:49361936-49361958 GACCGCCGAGGCGGCGGCCGGGG - Intronic
1150643510 17:66964761-66964783 GCGCTCCGACCCCGCGCCCCGGG - Intergenic
1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG + Exonic
1151854376 17:76710728-76710750 CTCCTCCGGCCCCGCGGGCGAGG + Exonic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152804971 17:82351387-82351409 GGGCTGGGACCCCGCGGCCGAGG + Intergenic
1153688117 18:7566935-7566957 GGCCTGCGACCCCGCGGGCGCGG - Exonic
1160529562 18:79555515-79555537 GACCCCTGACCCCGCGGATGAGG - Intergenic
1161218410 19:3106218-3106240 GACCTCACACCCCGCGGCTGGGG - Intronic
1161577914 19:5065002-5065024 GACCTCGGAACCCGAGGCGGAGG - Intronic
1162683771 19:12365364-12365386 CAGCTCCCACCCCGCGGCCGAGG + Intronic
1163122010 19:15223787-15223809 GACGTCGGAGCCCGCGGCGGAGG - Intergenic
1163585412 19:18161145-18161167 GACCCCCGAGGCCTCGGCCGAGG + Exonic
1164834732 19:31349777-31349799 GACCGCCGAGCCCCGGGCCGCGG - Intergenic
1167071765 19:47226268-47226290 GCCCTCAGTCCCCGCGGCCGCGG + Intronic
925607500 2:5673562-5673584 ATCCTCCGCCCGCGCGGCCGTGG - Intergenic
930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG + Intronic
933876130 2:86623387-86623409 GCCCTCCTGACCCGCGGCCGCGG - Exonic
938311165 2:130288843-130288865 GAGCTGCGACCCCGCAGGCGCGG - Intergenic
938537018 2:132255917-132255939 GGCACCCGACCCCCCGGCCGGGG + Intronic
941104884 2:161341108-161341130 CTCCTCCGGCCCCGCGGGCGAGG + Intronic
1174444609 20:50582237-50582259 GACCTCTGACCCCCAGGCAGAGG - Intronic
1174475834 20:50795152-50795174 GACCCCCGAGCCTGGGGCCGAGG + Exonic
1175895255 20:62333183-62333205 GGCCTCCAGCCCGGCGGCCGAGG + Exonic
1175970590 20:62684845-62684867 CACCTCCCACCCCATGGCCGTGG + Intronic
1178457635 21:32771093-32771115 GAGCTCCGGCCCCGTGGCAGAGG + Intronic
1180312638 22:11252570-11252592 GGCACCCGACCCCCCGGCCGGGG + Intergenic
1182561128 22:31160195-31160217 GACCTCCGACCCCTCCTACGCGG - Exonic
1183485361 22:38085284-38085306 GACCTCGGACCCCGCCTCAGCGG + Exonic
950438408 3:12993946-12993968 CAGCTCCGCCCCCGGGGCCGCGG - Intronic
952451645 3:33439609-33439631 GGACTCCGACCCCGCAGCCCAGG + Intronic
954878368 3:53817980-53818002 GCCCTCCGATCCCACTGCCGTGG - Exonic
960864332 3:122184474-122184496 CAGCTCCGGCCCCTCGGCCGTGG - Exonic
972918479 4:43907418-43907440 GGGCTCCGACCCAACGGCCGTGG - Intergenic
974009299 4:56592690-56592712 CGCCCCCGACCCCGCGGCCCAGG - Intronic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
984771919 4:183444197-183444219 GACCACAGGCCCCGCGGCTGCGG + Intergenic
987050469 5:14143764-14143786 GTCCTCCGGCCCCGCCGCGGCGG + Exonic
987286953 5:16466220-16466242 GACCTCGGAGCCCTCGCCCGTGG + Intergenic
991216838 5:64165763-64165785 CAGCCCCGACCCCGCGGCCTCGG - Intergenic
998228899 5:140346729-140346751 AGCCCCCGACCCCGCGGGCGCGG + Intergenic
1000232849 5:159331644-159331666 GACCTCCGCCCCTGCGGTGGGGG + Intergenic
1007431525 6:41779914-41779936 GACCTCCGACCCCGCGGCCGCGG - Intronic
1019308571 7:347865-347887 GAACCCCGTCCCCGCGGCCTGGG - Intergenic
1023812955 7:43926515-43926537 GCCATCCTACCCCGCTGCCGGGG - Exonic
1036162884 8:6406126-6406148 GACCTCCGATCCCGGGGATGGGG - Intergenic
1038542492 8:28401839-28401861 CACCTCCGGCTCCGGGGCCGCGG + Intronic
1045231238 8:100309596-100309618 CACCTCGGCCCCCGCGGCCCGGG + Intronic
1049419416 8:142510417-142510439 GCTCTCCGGCCCCGCGGCCCAGG - Intronic
1050537783 9:6645445-6645467 CGCCCCCGACCCCGCGGCCCAGG + Exonic
1056922410 9:90802117-90802139 GACCTCCGTCCCCTCCGCCCAGG - Intronic
1057489152 9:95508378-95508400 AGCCTCCGTCCCCGCGGCGGCGG - Exonic
1057489276 9:95508882-95508904 ACCCTCGGACCCCGCGGCGGCGG - Intronic
1062012902 9:134276399-134276421 GACCTCGGAACCCGCAGCCTCGG + Intergenic
1062021243 9:134320332-134320354 GGCCTTCGTCCCCGGGGCCGCGG + Intronic
1062565642 9:137162829-137162851 GCCCTCCGACCCTGCAGCTGAGG + Exonic
1062578892 9:137221188-137221210 GCCCTCTGACCCCGGGCCCGAGG - Exonic
1198386568 X:136134722-136134744 GGGCTCCGACCCCACGGCAGTGG + Intergenic