ID: 1007432765

View in Genome Browser
Species Human (GRCh38)
Location 6:41786292-41786314
Sequence CTCGAGCTGGGCCGGGGCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007432753_1007432765 20 Left 1007432753 6:41786249-41786271 CCTGCTGCCCCAGCTGCTTCGAG 0: 1
1: 0
2: 1
3: 26
4: 411
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1007432756_1007432765 11 Left 1007432756 6:41786258-41786280 CCAGCTGCTTCGAGAACCGCTAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1007432754_1007432765 13 Left 1007432754 6:41786256-41786278 CCCCAGCTGCTTCGAGAACCGCT 0: 1
1: 0
2: 0
3: 10
4: 72
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1007432752_1007432765 21 Left 1007432752 6:41786248-41786270 CCCTGCTGCCCCAGCTGCTTCGA 0: 1
1: 0
2: 0
3: 45
4: 271
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1007432759_1007432765 -5 Left 1007432759 6:41786274-41786296 CCGCTACTCGGATGCAGGCTCGA 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1007432755_1007432765 12 Left 1007432755 6:41786257-41786279 CCCAGCTGCTTCGAGAACCGCTA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1007432751_1007432765 22 Left 1007432751 6:41786247-41786269 CCCCTGCTGCCCCAGCTGCTTCG 0: 1
1: 0
2: 2
3: 69
4: 587
Right 1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007432765 Original CRISPR CTCGAGCTGGGCCGGGGCAC TGG Exonic
900417906 1:2543485-2543507 CAGGGGCTGGGCCGGGGTACTGG - Intergenic
900651472 1:3732158-3732180 TTGGACCTGGGCCGCGGCACTGG - Intronic
900712395 1:4122643-4122665 CCCCAGCTGGCCCGGGGCTCTGG - Intergenic
901721794 1:11204580-11204602 CTCCTGCTGGGCCCTGGCACAGG - Exonic
902764568 1:18605834-18605856 ACCGAGCTGGGCCGGCGCAGCGG - Intergenic
902881281 1:19373367-19373389 ATGGAGCTGGGCCAGGGGACGGG - Intronic
904252729 1:29236572-29236594 CTCGGGCTGGGCTCGGGCTCCGG + Exonic
905226399 1:36481907-36481929 ATCGAGCTGTGCTGGGCCACAGG - Intronic
905412692 1:37782650-37782672 CTGGAGCTGGGTTCGGGCACCGG - Intergenic
905671043 1:39789915-39789937 GTAGAGCTGGGCTGGGGCAGGGG + Intergenic
906288835 1:44606106-44606128 CTCCCGCTGGGGCGGGGCAGCGG - Intronic
906315543 1:44784497-44784519 GGCGGGCTGAGCCGGGGCACAGG + Intronic
906686199 1:47765030-47765052 ATTGAGCTGGGCCGAGGGACTGG - Exonic
907453096 1:54559845-54559867 CTCCAGCTGGGCAGGGGCCCTGG + Intronic
908679891 1:66648823-66648845 GTCGACCTGGGCTGGGGCCCAGG - Intronic
914859331 1:151373189-151373211 CACGAGCTGGTCAGGGGCAGCGG - Intergenic
915489831 1:156244889-156244911 CTCGGGCTGTGCTGGGGCAGGGG - Exonic
915625971 1:157114369-157114391 CTTCACCTGGGCTGGGGCACTGG + Intergenic
915937759 1:160098917-160098939 CTGGGGCTGGGCCGAGGCCCGGG - Intronic
915937793 1:160099002-160099024 CTGGGGCGGGGCCGGGGCCCGGG - Intergenic
919796758 1:201325542-201325564 CTCTAGGTGGGCAGGGGCATGGG + Intronic
919919819 1:202161218-202161240 GGAGAGCTGGGCCGTGGCACAGG - Exonic
920331475 1:205211441-205211463 CGCGAGCTGTGCCGGGGCTTCGG - Exonic
921029705 1:211326772-211326794 CTGGGGCGGGGCCGGGGCGCGGG - Intronic
922505319 1:226122490-226122512 CCCAGGCCGGGCCGGGGCACTGG - Intergenic
922791662 1:228314419-228314441 GGCGAGCTGGGCTGGGGCTCTGG + Intronic
924801964 1:247334264-247334286 ATAGAGCTGGGTGGGGGCACAGG + Intergenic
1063145621 10:3292727-3292749 CTTGTGCTGGGGTGGGGCACTGG + Intergenic
1063376768 10:5558662-5558684 CTCAAGCTGTGCCAGGGCACAGG + Intergenic
1067469688 10:46527560-46527582 CTGGAGCTGAGCCCGGGCTCAGG + Intergenic
1068767504 10:60779094-60779116 CTCCAGGTGGGCCGGGGCCGTGG - Intronic
1073812228 10:107164240-107164262 CTGGAGCGGGCTCGGGGCACTGG - Exonic
1076434433 10:130430495-130430517 CTTGAGCAGGGCCAGTGCACAGG - Intergenic
1076683745 10:132187527-132187549 CCCGGGCTGGTCCGGGGCGCGGG + Intronic
1076822020 10:132944161-132944183 AGCCAGGTGGGCCGGGGCACAGG + Intergenic
1076898316 10:133325070-133325092 CTGGTGCTGGGCCTGGGCCCCGG - Intronic
1077334019 11:1995350-1995372 CTCCATCTGGGCCGGGTGACTGG - Intergenic
1077365506 11:2159967-2159989 GTGGAGCTGGGCGGGGGCCCTGG - Exonic
1077442067 11:2573550-2573572 CTGGAGCCGGGCCTGGGCAGTGG + Intronic
1078062893 11:8059898-8059920 CTCGATCCGGGCAGAGGCACTGG + Intronic
1081802744 11:45870886-45870908 CTCGAGCTGGGCTCTGCCACAGG - Exonic
1083861691 11:65423398-65423420 CTCGGCCTGGGACGGGGCCCAGG + Intergenic
1084008450 11:66335143-66335165 CAAGAGCTGGACCAGGGCACCGG - Exonic
1084595091 11:70112077-70112099 CCCCAGCTGGCCCGGGGCTCTGG + Intronic
1089293058 11:117450037-117450059 CTCGACCAGGGCCTGGGCTCAGG - Intronic
1089864819 11:121622567-121622589 CTGCAGCTGGGCTGGGGCTCAGG + Intronic
1091090023 11:132762655-132762677 CTCGAGCTTGGTGGGGGGACGGG - Intronic
1202817002 11_KI270721v1_random:50532-50554 CTCCATCTGGGCCGGGTGACTGG - Intergenic
1092166879 12:6347923-6347945 CTGGAGATGGGCGGGGGCCCAGG + Exonic
1093828077 12:23719680-23719702 CTCAAACTGGGCAGGGGCTCAGG - Intronic
1096773408 12:53950350-53950372 CCAGAGCTGGGCCGGGCCAGTGG + Intergenic
1096972929 12:55681977-55681999 CTGGAGCTGGGCTGCGGAACCGG + Exonic
1097107667 12:56634945-56634967 CTGGAGCAGGGCCGGGCCGCAGG + Intronic
1099107902 12:78519221-78519243 CTCGAGCTTGGTCGGGGGAGGGG + Intergenic
1099236099 12:80084116-80084138 CTCGAGCTTGGTCGGGGGAGGGG - Intergenic
1102979094 12:117227414-117227436 CTCGAGGTGGGCGGAGGCACTGG - Exonic
1104222490 12:126798497-126798519 CTGGAGCAGGGCCGGCCCACAGG - Intergenic
1104645018 12:130491078-130491100 CTGGAGCTGGGCTGGGTCTCAGG - Intronic
1104736758 12:131139870-131139892 CTCGAGCTCGGCTTGGGCAGGGG - Exonic
1107467897 13:40666145-40666167 CACGAGCGCGGCCGGGGCAGCGG + Exonic
1109271302 13:60258572-60258594 CTCGAGCTTGGTCGGGGGAGGGG + Intergenic
1116876396 14:50116317-50116339 CTGGAGCTGGGTTCGGGCACCGG - Exonic
1117298079 14:54396989-54397011 CGCGGGCTCGGCCGGGGCACCGG + Exonic
1119320867 14:73729590-73729612 CAGGAGCGGGGCTGGGGCACTGG - Intronic
1122115006 14:99523196-99523218 CTGGGGCTGGGCTGGGGCAGGGG + Intronic
1122128917 14:99593841-99593863 CTGGGGCTGGGCACGGGCACTGG + Intronic
1122624179 14:103075712-103075734 CTCGAGCCGGGAGGGGGCGCTGG + Intergenic
1122719278 14:103713120-103713142 CCAGAGCTGGGCAGGGGCAGAGG - Intronic
1122889031 14:104724180-104724202 ATGGAGCCGGGCCGGGGCAGGGG - Intronic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1123569718 15:21591727-21591749 CTCTGACTGGGCCGGGCCACAGG + Intergenic
1123605828 15:22027046-22027068 CTCTGACTGGGCCGGGCCACAGG + Intergenic
1124118268 15:26867395-26867417 GGCGCGCTGGGCCGGGGCAGTGG + Intronic
1125999457 15:44195286-44195308 CGCGAGCTGGGCACGGGCACTGG - Intergenic
1128547525 15:68578488-68578510 CTCGCGCTGGCCCGGGGCACAGG - Intergenic
1129302423 15:74633083-74633105 TTAAAGCTGGGCCAGGGCACAGG + Intronic
1131053483 15:89362620-89362642 CTAGAGCTGGGCCTGAGCCCGGG + Intergenic
1131523479 15:93134463-93134485 CTGGAGTTGGGCAGGGGGACAGG + Intergenic
1132403942 15:101530989-101531011 CTCCACCTGGGCAGGGGCTCAGG - Intergenic
1132504508 16:300676-300698 CTGGAGCAGAGCCGGGGGACAGG + Intronic
1132719508 16:1308980-1309002 CTGGCCCTGGGCCGGGGCGCGGG - Exonic
1132834778 16:1947276-1947298 CTCCAGCCGGGCCTGGGCCCAGG + Exonic
1132850699 16:2023713-2023735 CTGGACCTGGACCGGGGCTCCGG - Intergenic
1132887575 16:2189390-2189412 CCCGAGCGGGGGCGGGGCAGCGG - Intronic
1133285853 16:4690360-4690382 CTGCAGCTGGGCCTGGGGACAGG + Exonic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1136414682 16:30096042-30096064 CGCGGGCTGGGCAGGGGCGCGGG + Exonic
1137582280 16:49640747-49640769 CTTGAGCTGGGCTGGGGAGCTGG - Intronic
1141798697 16:86292379-86292401 CAGGAGCTGCCCCGGGGCACGGG - Intergenic
1142855522 17:2727330-2727352 CTGGAGCTGGACCTGGGAACTGG + Intergenic
1142968527 17:3595903-3595925 CCTGGGCTGGGCCGGGGAACAGG + Intronic
1143545527 17:7593010-7593032 CTCGAAGTGGGCCGGGGGGCAGG + Exonic
1144834129 17:18148133-18148155 CTCGAGCTGGGTCGGGGGTAAGG - Exonic
1146086864 17:29838161-29838183 CTGAAGCTGAGCCTGGGCACTGG + Intronic
1147120043 17:38330490-38330512 CTCGAGCTGGGGCAGGGGAGTGG + Exonic
1147443725 17:40462502-40462524 CTGGGGCTGGGCTGGGGCCCAGG + Intergenic
1147452924 17:40517213-40517235 CTAGGGCTGGGCCTGGGCATCGG + Intergenic
1149914928 17:60600227-60600249 CGAGAGCTGGGCCGGAGCGCCGG - Exonic
1150302495 17:64057898-64057920 CTCGGGCCGGGCAGGGGCATGGG + Exonic
1150806615 17:68324453-68324475 CTGGAGCTGGGCCGGTCCGCAGG - Intronic
1151476420 17:74346532-74346554 CCACAGCTGGGCCTGGGCACTGG + Intronic
1152852885 17:82648144-82648166 CTCGGGCGGGGCCGGGGTCCCGG + Intronic
1152880538 17:82812213-82812235 CCACAGCTGGGCCCGGGCACAGG - Intronic
1155501559 18:26491909-26491931 CTGGAGCAGGGACTGGGCACAGG - Intronic
1156290892 18:35747907-35747929 CTTGAGCTGGGCCTGGGGACTGG - Intergenic
1156493098 18:37507998-37508020 CTGGACCTGGGCTGGGGCAGGGG - Intronic
1160382557 18:78471756-78471778 CTCCAGCAGGGCCAGGGCATGGG + Intergenic
1160663358 19:311787-311809 CTCGATCTGGGGAGGGGCTCAGG - Intronic
1160768887 19:821716-821738 CGCGTGCTGGGCCGGGGCGCGGG - Intronic
1160843703 19:1157437-1157459 CTCGGGGTGGGCCGTGTCACCGG - Intronic
1161152503 19:2717043-2717065 CTCGGGGTGGGCAGGGGCAGCGG + Exonic
1161310323 19:3590235-3590257 CTGGAGCAGGGCCGGGGCAGGGG - Exonic
1161320437 19:3638382-3638404 CTTGAGGAGGGCCGGGGGACCGG - Intronic
1161372004 19:3917799-3917821 CTGGGGCTGGGTCGGGGCAGCGG + Intronic
1161593054 19:5137378-5137400 CTGGAGTGGGGCCGGGGCCCAGG - Intronic
1161981715 19:7633488-7633510 CTGGCACTGGGCCGGGGCAGAGG - Exonic
1163557581 19:18001345-18001367 CTGGAGCTGGCGCGGGGCCCGGG + Intronic
1163759825 19:19130155-19130177 CTCGAGCTGGGCCTGGAGCCTGG - Exonic
1165960773 19:39532594-39532616 CTGGGGATGGGCCCGGGCACAGG + Exonic
1166181647 19:41113101-41113123 CTGGAGCTGGGCCAGGGCTCTGG - Intergenic
1166299340 19:41905236-41905258 CTCGGGCTGGGCCGGGGCTTAGG - Exonic
1166994005 19:46710703-46710725 GTGGGGCTGGGCCGGGGCTCAGG - Intronic
1167648867 19:50719200-50719222 TGCGATCTGGGACGGGGCACCGG + Intronic
1167696306 19:51017347-51017369 TTGGAGCTGGGCTGTGGCACTGG + Intronic
1168344266 19:55642726-55642748 CTCGCGCTGGGGCGGGCCCCGGG - Exonic
924962477 2:46627-46649 CGCGGCCAGGGCCGGGGCACCGG - Intronic
925158338 2:1663852-1663874 CTCCACCTGGGTCGGGGCGCCGG + Intronic
925265170 2:2561939-2561961 CTCGCTCTGTGCTGGGGCACAGG - Intergenic
926231709 2:11009205-11009227 CTTGAGCTGGGCCTGGGTCCAGG + Intergenic
931681215 2:64751197-64751219 CGCGAGCGGGGCGGGGGCAGTGG + Intergenic
933720928 2:85397195-85397217 CTAGAGCTGGGCTAGGGCAGTGG + Intronic
937261149 2:120587418-120587440 CGCGGGCCGGGCCGGGGCAGGGG - Intergenic
937290078 2:120776742-120776764 CTGGGGCTGAGCCGGGGCAGAGG + Intronic
940856280 2:158730859-158730881 CACTGGCTGGGCAGGGGCACTGG - Intergenic
945245321 2:207711939-207711961 CCCAAGCTGGGCCGGCGCGCGGG + Exonic
945467047 2:210181614-210181636 CTCGAGCTTGGTCGGGGGAGGGG + Intergenic
946301435 2:218826882-218826904 CTCGGGCTGGGCTGGGGCCTGGG - Intronic
946415935 2:219539711-219539733 CCAGAGCTGGGCCGTGACACTGG - Exonic
947626531 2:231622662-231622684 CTGGAGCTGGGGCTGGGCAGAGG - Intergenic
948080722 2:235203122-235203144 CTGGGGCTGGGCCAGGGCAGTGG + Intergenic
948199490 2:236119577-236119599 CTGGAGCTGGGCCGGGGGTGGGG - Intronic
948922718 2:241073269-241073291 CTCGAGCTGCGCCGAGGCTGTGG - Exonic
1170896565 20:20420222-20420244 GACAAGCTGGGCCTGGGCACAGG + Intronic
1171173315 20:23034306-23034328 CTCTAGCTGGCACAGGGCACAGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171467323 20:25338979-25339001 CTCCAGCTGGGAAGGGGCACAGG + Intronic
1171867261 20:30496795-30496817 CTCCAGCCGGGGCGGGGGACAGG + Intergenic
1172293738 20:33793425-33793447 CTGGAGCTGGGCCTTGGCCCGGG + Intergenic
1173414772 20:42845855-42845877 CTCCAGCTGGTCCAGGGCTCAGG + Intronic
1173606771 20:44337246-44337268 CTCGGGCTGGGCCGGGGCTGGGG - Exonic
1174151412 20:48488948-48488970 CAGGAGCAGGGCCGGGGCCCAGG + Intergenic
1175445878 20:59019015-59019037 CTCCTGCTGTGGCGGGGCACGGG + Intergenic
1175931265 20:62494902-62494924 CTCGACCTGGGCCCTGGGACAGG + Intergenic
1176119717 20:63448793-63448815 GACCTGCTGGGCCGGGGCACTGG + Intronic
1178288245 21:31343969-31343991 CTCGTTCTGGGAAGGGGCACGGG + Intronic
1179479277 21:41667328-41667350 CCAGAGCTGGGCCTGGGCAAAGG + Intergenic
1179884931 21:44309839-44309861 CACCAGCTGGGCTGGGGGACAGG - Intronic
1179949956 21:44703875-44703897 CAGGAGCTGGGCGGTGGCACTGG - Intronic
1180048027 21:45318671-45318693 CTGGAGCTGGGCCGGGGTCGGGG - Intergenic
1180053900 21:45347236-45347258 CGCGGGCTGGGCAGCGGCACAGG + Intergenic
1180065548 21:45410392-45410414 CTGGTGCTGGGGCCGGGCACTGG + Intronic
1180211480 21:46297566-46297588 GACGAGCTGGGCCGACGCACGGG + Exonic
1180948568 22:19710109-19710131 CTCCTGCTGGGTGGGGGCACAGG - Intergenic
1181026653 22:20131222-20131244 ATCGGGCAGGGCCGGGGCGCCGG + Intronic
1182429582 22:30291876-30291898 CTGGTGCTGGGCTGGGGCCCAGG + Intronic
1183368582 22:37419884-37419906 GCCGCGCTGGGCAGGGGCACAGG - Intronic
1183376714 22:37469655-37469677 CTTGAGCTGGGCTGGGGCTCAGG - Exonic
1183455784 22:37922351-37922373 CTGGAGCGGGGCCGGGGCGTGGG - Exonic
1185210626 22:49568704-49568726 CTCGAGAAGGGCAGAGGCACAGG - Intronic
1185371766 22:50464290-50464312 CTCCAGCCGGGCCAGGGCAGCGG - Intronic
950193169 3:10992111-10992133 CTAGAGCAGGGAGGGGGCACGGG + Intergenic
951183169 3:19682498-19682520 CTGGAGCTGGGCGGGGGGAGGGG - Intergenic
952711700 3:36438377-36438399 ATGGAGCTGGGCCATGGCACTGG + Intronic
954612850 3:51955409-51955431 CTGGAGCTGGGCTGGGGCAGGGG + Exonic
954686526 3:52373091-52373113 CGCGTGCTGTGCAGGGGCACAGG + Intronic
961621293 3:128226996-128227018 CCCGAGAGGGGCCGGGGCAGGGG - Intronic
968487898 4:872701-872723 CTTGAGATGGCCCTGGGCACTGG + Intronic
968570977 4:1340541-1340563 CAGGAGCTGCGACGGGGCACTGG - Intergenic
968596858 4:1490219-1490241 CTGGAGCTGTTCCGGGGCCCTGG + Intergenic
968656071 4:1778989-1779011 CTCGAGCAGGGTCAGGGCAAGGG - Intergenic
982042289 4:151408661-151408683 GCAGAGCTGGGCCGGGGCGCCGG + Intergenic
984055976 4:174929625-174929647 CTCCAGCTGGCCTTGGGCACTGG - Intronic
987041753 5:14069241-14069263 CTGGAGCAGAGCCAGGGCACGGG - Intergenic
988882351 5:35517060-35517082 CTCCATCTGGGGCAGGGCACTGG - Intergenic
988949276 5:36241448-36241470 CCCGGGCTCGGCCGGGGCTCTGG - Intronic
990638003 5:57750825-57750847 CTCGAGTTTGGCTGGGGCAGTGG - Intergenic
995179658 5:109219171-109219193 CTGGAGCTGAGCCTGGGCTCTGG + Intergenic
999248416 5:150167397-150167419 CCCGAGCAGGGCCGGAGCAGAGG - Intronic
1002025303 5:176392724-176392746 CATGGGCTGGGCCTGGGCACAGG - Exonic
1002106784 5:176883299-176883321 TTGGAGCTGGGCGGGGGCAGGGG - Intronic
1002296125 5:178232339-178232361 CTCCAGCGGGGCCGGGGCAGCGG + Intronic
1002665781 5:180823510-180823532 CTCCTGCTGGACCTGGGCACAGG - Intergenic
1002771235 6:292290-292312 CGGGAGCCGGGCAGGGGCACCGG - Intronic
1003084523 6:3051152-3051174 CTCCAGCTGTGCAGGAGCACAGG + Intergenic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1004144012 6:13047879-13047901 GAGGAGCTGGGCCGGGGCTCGGG - Intronic
1006141846 6:31934004-31934026 CTGGATCTGGGCCGGAGCAAGGG + Intronic
1006419697 6:33925404-33925426 CTGGAGCTGGGCCTGGGAGCCGG - Intergenic
1006514823 6:34539833-34539855 CCTGGGCTGGGGCGGGGCACTGG + Intronic
1006777417 6:36606377-36606399 CTGGAGCTGGGCAGTGGCAATGG + Intergenic
1006796766 6:36737131-36737153 CTGGTGGTGGGCCGGGGCCCGGG + Intergenic
1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG + Exonic
1007709084 6:43810297-43810319 CTGGGGCTGGGCTGGGGCAAGGG + Intergenic
1013472375 6:110476680-110476702 CTCGCGCTGGTCCCGAGCACTGG - Intergenic
1017968694 6:159290376-159290398 CTCGAGCTTGGCTGGGGGAGTGG - Intergenic
1018025217 6:159800422-159800444 CTCAAGCTCGCCCGGGGCAAGGG - Intronic
1028918537 7:96286371-96286393 CTTGGGCTGGCTCGGGGCACAGG - Intronic
1034188317 7:149195803-149195825 CGCGGGCTGGGCCGCGGGACCGG + Intronic
1034483609 7:151341980-151342002 GTGGAGCTGGGCCGGGGCCGGGG + Intronic
1035203866 7:157282182-157282204 CTAGGGCTGGGCCAGGGGACTGG + Intergenic
1036482571 8:9151433-9151455 CAGGAGCTGGGCCCGGGCTCGGG + Intronic
1037116768 8:15237135-15237157 CCCGTGCCGGGCTGGGGCACAGG + Intronic
1039841895 8:41299626-41299648 CTCTACCTGGGCTGGAGCACAGG - Intronic
1044728082 8:95209046-95209068 CTTGGGCAGGGCCGGAGCACAGG - Intergenic
1045010080 8:97951228-97951250 CTCTGGCTGTGCCAGGGCACAGG + Intronic
1046088390 8:109467405-109467427 CTTGAGTTGGGGCGGGGCAGTGG - Intronic
1049239461 8:141529716-141529738 CTGGAGCTTGGCGGGGGTACAGG + Intergenic
1049305325 8:141899800-141899822 CCAGAGCTGGGACGGGGCCCTGG - Intergenic
1049354170 8:142179460-142179482 CTGGAGTGGGGCCGGGGGACGGG + Intergenic
1049441824 8:142613084-142613106 CTCGGGCTGGGTCCGGTCACTGG + Exonic
1049708120 8:144052032-144052054 TTCGAGCTGCGGCGGGGCTCGGG - Exonic
1052821076 9:33138239-33138261 GTGGAGCTGGACCGGGGCCCAGG - Intronic
1053586480 9:39464271-39464293 CTCGGCCTGGGCCCGCGCACTGG + Intergenic
1054579826 9:66900962-66900984 CTCGGCCTGGGCCCGCGCACTGG - Intronic
1054785632 9:69207555-69207577 CTCTACCTGGGCAGAGGCACCGG - Intronic
1055397293 9:75889712-75889734 CTGGAGCGGGGGTGGGGCACAGG - Intergenic
1056832665 9:89929482-89929504 CACAGGCTGGGCCGGGGCACTGG - Intergenic
1056992339 9:91423711-91423733 CTCGGGCCGGGCCGGGCCTCCGG + Exonic
1059513360 9:114870008-114870030 CTCGAGCTTGGCTGGGGGAGGGG + Intergenic
1060479993 9:124012220-124012242 CTCGGGCGGGGCCGGGGCCGCGG + Exonic
1060596873 9:124853763-124853785 CTGGAGCTGGGGCCCGGCACTGG - Intronic
1061444746 9:130631483-130631505 CTCGGGGTGGGCCTGGGCAGAGG + Intronic
1062188267 9:135230123-135230145 CTGGAGTTGGGCCGGGCCATGGG - Intergenic
1062395334 9:136350482-136350504 CTCCAGCTGGGCCAAGGTACTGG + Intronic
1062542230 9:137046550-137046572 CACGAGCTGGGCAGGTGCACAGG + Intergenic
1191793782 X:64999739-64999761 CTCGAGCTTGGTAGGGGGACGGG + Intronic
1191878591 X:65822185-65822207 CCCAAGCTGGGCCGGCGCGCCGG - Intergenic
1192233520 X:69281800-69281822 CTCCAGCAGGACCGGGGCATTGG - Intergenic
1196308055 X:114127646-114127668 CTCGAGCTTGGTCGGGGGAGGGG - Intergenic
1197004080 X:121474720-121474742 CTTGAGCTTGGTTGGGGCACAGG - Intergenic