ID: 1007432839

View in Genome Browser
Species Human (GRCh38)
Location 6:41786530-41786552
Sequence AACCCACCCCGCGCCGCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007432830_1007432839 7 Left 1007432830 6:41786500-41786522 CCCTGGCCGGAGCGTTCCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45
1007432832_1007432839 6 Left 1007432832 6:41786501-41786523 CCTGGCCGGAGCGTTCCAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45
1007432825_1007432839 27 Left 1007432825 6:41786480-41786502 CCGCAGCTCTCACCGCGCATCCC 0: 1
1: 0
2: 1
3: 14
4: 204
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45
1007432834_1007432839 -9 Left 1007432834 6:41786516-41786538 CCAAGGGCCGCCCGAACCCACCC 0: 1
1: 0
2: 0
3: 21
4: 179
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45
1007432824_1007432839 28 Left 1007432824 6:41786479-41786501 CCCGCAGCTCTCACCGCGCATCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45
1007432828_1007432839 15 Left 1007432828 6:41786492-41786514 CCGCGCATCCCTGGCCGGAGCGT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45
1007432833_1007432839 1 Left 1007432833 6:41786506-41786528 CCGGAGCGTTCCAAGGGCCGCCC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007432839 Original CRISPR AACCCACCCCGCGCCGCGGT CGG Intronic
903694528 1:25197243-25197265 AAGCCACCCCGGGCCAGGGTGGG + Intergenic
905819753 1:40980080-40980102 AAGCCGCCCCGCGCCCCGCTTGG - Intronic
910449541 1:87331583-87331605 AACCCACCCACCGCCGCGCCCGG - Intronic
920348346 1:205321362-205321384 AGCCCGCCCCGCGCCGCGAGAGG + Intronic
922420852 1:225460403-225460425 ACCCCACCCCGGGCCTCTGTTGG + Intergenic
1064764757 10:18659556-18659578 CGCGCAGCCCGCGCCGCGGTGGG + Exonic
1070841092 10:79488370-79488392 AACCCACCCTGCTCCCCAGTAGG - Intergenic
1078317223 11:10303983-10304005 AATCCACGCCGCGCCCCAGTCGG + Intergenic
1078474771 11:11621290-11621312 AGCGCACCCCGCGCCGCGCGGGG + Intronic
1078514364 11:12009398-12009420 GGCCCACCCCGCCCCGCGGAGGG + Intronic
1081616810 11:44596160-44596182 AACCCACCCCAGGCCGGGCTTGG + Intronic
1084265510 11:68003505-68003527 AACCCCACCCCCGCCGCGGGGGG + Intronic
1085050153 11:73376276-73376298 GACTCACCCCGAGCCGCGGAGGG - Exonic
1106517010 13:30464931-30464953 TCCCCTCCCCCCGCCGCGGTGGG + Intronic
1106568518 13:30906702-30906724 AAGCCCCCCCGCGCCGCCGCCGG - Exonic
1113656204 13:112068902-112068924 AAGCCACGCCGCGCCGGGGCGGG - Exonic
1113807350 13:113117618-113117640 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807360 13:113117655-113117677 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807371 13:113117692-113117714 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807382 13:113117729-113117751 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807391 13:113117766-113117788 TACCCACCCAGCACCGCGGTCGG - Intronic
1120216263 14:81683525-81683547 CACCCACCCCACCCCGCGGGGGG - Intergenic
1123071002 14:105642536-105642558 AACAAACCCCGCGCTGAGGTTGG - Intergenic
1131892153 15:96984263-96984285 GAGCCTCCCCGCGCCGCCGTGGG - Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1144874481 17:18390332-18390354 AACCGACCCCGCACCAGGGTGGG + Intergenic
1145094143 17:20009784-20009806 ACCCCAGCCCTCGCCGCAGTGGG + Intronic
1146797929 17:35795687-35795709 CACCCACCCCGCGCCGCTGCTGG + Intronic
1148870954 17:50658601-50658623 ATCCCACCCCCCACCGCAGTGGG + Intronic
1157473665 18:48008258-48008280 AACCGACCCCGCCCCGCCGCGGG + Intergenic
1161277888 19:3428946-3428968 AACCAACCCTGCCCCGCGCTGGG - Intronic
1161560194 19:4968942-4968964 CGCCCACCGCGCGCCGCGATTGG - Intergenic
1161683354 19:5691468-5691490 ATCCCACCCCGCCCCTCGGCCGG - Intronic
973159071 4:46993554-46993576 CAGCCAGCCCGAGCCGCGGTGGG + Exonic
992550168 5:77852072-77852094 CACCCGCCCCGGGCCGCGGGAGG + Intronic
995764590 5:115602045-115602067 AGCCCACCCCGCGCCCCCGGCGG + Intronic
997391983 5:133524675-133524697 AACCCACCCAGGGGCGGGGTGGG - Intronic
1002498905 5:179634542-179634564 AACCCGCCCCGCGCTCCGGCCGG - Intronic
1002502771 5:179657982-179658004 AACCCGCCCCGCGCTCCGGCCGG + Intergenic
1003324959 6:5084660-5084682 AGCCCACCCCGCGCCGCCACTGG + Exonic
1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG + Intronic
1024565436 7:50676330-50676352 AACCCCCCCCCCCCCCCGGTGGG - Intronic
1026332609 7:69365844-69365866 AACCCACCCAGCGCAGGGGATGG + Intergenic
1045489089 8:102655751-102655773 AGCCTGCCCCGCGCCGCGGGCGG + Exonic
1049524755 8:143117853-143117875 AACCCACCCCCCACCCCGGGGGG + Intergenic
1049680550 8:143916110-143916132 AACGGCCCCCGCGCCTCGGTGGG + Exonic
1049850534 8:144827797-144827819 AGCCCACCTCGCGCCGCCGCGGG - Intronic
1057596587 9:96419367-96419389 AGCCCCACCCGGGCCGCGGTCGG - Intergenic
1192502533 X:71663364-71663386 AACCCACGCCCTGCCCCGGTGGG + Intergenic
1192509735 X:71714740-71714762 AACCCACGCCCTGCCCCGGTGGG + Intronic
1192516962 X:71766813-71766835 AACCCACGCCCTGCCCCGGTGGG - Intronic
1192523612 X:71823346-71823368 AACCCACCCCCTGCCCCAGTGGG - Intergenic