ID: 1007436797 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:41818986-41819008 |
Sequence | GAGTCTCCCTAAAGGAAAGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1007436793_1007436797 | 18 | Left | 1007436793 | 6:41818945-41818967 | CCTGTGTGTCATTCTGCTTGGGA | 0: 1 1: 0 2: 2 3: 11 4: 169 |
||
Right | 1007436797 | 6:41818986-41819008 | GAGTCTCCCTAAAGGAAAGTGGG | No data | ||||
1007436794_1007436797 | -8 | Left | 1007436794 | 6:41818971-41818993 | CCACATTAGTATTAAGAGTCTCC | 0: 1 1: 0 2: 1 3: 19 4: 82 |
||
Right | 1007436797 | 6:41818986-41819008 | GAGTCTCCCTAAAGGAAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1007436797 | Original CRISPR | GAGTCTCCCTAAAGGAAAGT GGG | Intronic | ||
No off target data available for this crispr |