ID: 1007436797

View in Genome Browser
Species Human (GRCh38)
Location 6:41818986-41819008
Sequence GAGTCTCCCTAAAGGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007436793_1007436797 18 Left 1007436793 6:41818945-41818967 CCTGTGTGTCATTCTGCTTGGGA 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1007436797 6:41818986-41819008 GAGTCTCCCTAAAGGAAAGTGGG No data
1007436794_1007436797 -8 Left 1007436794 6:41818971-41818993 CCACATTAGTATTAAGAGTCTCC 0: 1
1: 0
2: 1
3: 19
4: 82
Right 1007436797 6:41818986-41819008 GAGTCTCCCTAAAGGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007436797 Original CRISPR GAGTCTCCCTAAAGGAAAGT GGG Intronic
No off target data available for this crispr