ID: 1007438131

View in Genome Browser
Species Human (GRCh38)
Location 6:41832375-41832397
Sequence CAGTACATACATATGTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007438131_1007438135 12 Left 1007438131 6:41832375-41832397 CCTAGCTACATATGTATGTACTG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1007438135 6:41832410-41832432 GTCCTAGTATAAACAAAATTGGG No data
1007438131_1007438134 11 Left 1007438131 6:41832375-41832397 CCTAGCTACATATGTATGTACTG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1007438134 6:41832409-41832431 AGTCCTAGTATAAACAAAATTGG 0: 1
1: 0
2: 0
3: 16
4: 177
1007438131_1007438137 22 Left 1007438131 6:41832375-41832397 CCTAGCTACATATGTATGTACTG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1007438137 6:41832420-41832442 AAACAAAATTGGGTATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007438131 Original CRISPR CAGTACATACATATGTAGCT AGG (reversed) Intronic
911224690 1:95292195-95292217 CAAAGCATAAATATGTAGCTTGG + Intergenic
913503464 1:119493608-119493630 AATTACATACATGTGTATCTGGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
918855519 1:189751038-189751060 CAGAACATATATATGCATCTTGG + Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919065779 1:192691469-192691491 AACTATGTACATATGTAGCTAGG - Intergenic
919334735 1:196217937-196217959 AAGTACAAATATATCTAGCTTGG + Intergenic
920854328 1:209651116-209651138 CAGCAGATACATTTGTAGCTTGG + Exonic
923669555 1:236028879-236028901 TAGTACATACAGATGTGGCCGGG + Intronic
1067248252 10:44564843-44564865 CAGTAAATACGTTTGTAGCATGG - Intergenic
1071172387 10:82881691-82881713 AAATACATAGATATATAGCTAGG - Intronic
1074972717 10:118552374-118552396 CAGTACATACTTTTGTATGTTGG + Intergenic
1075107077 10:119547220-119547242 ACGTACATACATAAGTAGCAGGG - Intergenic
1075162804 10:120039774-120039796 TAGGACATACATATTTGGCTGGG + Intergenic
1077693152 11:4367719-4367741 CATTACATGCATATTTGGCTAGG + Exonic
1078753279 11:14185333-14185355 CAGTTCATACATATAGATCTTGG - Intronic
1079914856 11:26356215-26356237 AATTACTTACATATGTATCTAGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085091920 11:73723898-73723920 CAGTATATAGATATGTGGGTAGG - Intronic
1088200263 11:107324723-107324745 CAGTACATAAATAAGTGGATTGG + Intergenic
1098650942 12:72967723-72967745 AAGTTTATACACATGTAGCTTGG + Intergenic
1098939360 12:76517173-76517195 CAATACATAAATATGGAGTTTGG - Intronic
1099111374 12:78565896-78565918 CTATACATACTGATGTAGCTTGG - Intergenic
1099472454 12:83068295-83068317 TAGAACATACATATATAGGTGGG - Intronic
1102902314 12:116647941-116647963 CAGCAGATACGTATGTAACTAGG - Intergenic
1106125735 13:26898552-26898574 GAGGAGACACATATGTAGCTGGG + Intergenic
1109492855 13:63126455-63126477 CAGTCCACAGATCTGTAGCTTGG - Intergenic
1110384340 13:74891381-74891403 CAGTACATACATAAGTTGTATGG + Intergenic
1111901040 13:94199993-94200015 CTGAACATACAAATTTAGCTGGG + Intronic
1116309003 14:43296752-43296774 CACTTCATTCATATGTAGGTGGG + Intergenic
1117256600 14:53984612-53984634 CAGCACATCAATATGAAGCTGGG - Intergenic
1117349258 14:54864921-54864943 CCATACATACATATCTATCTTGG + Intronic
1120541693 14:85759118-85759140 CAGTACATTCAGAAGTAGCTTGG - Intergenic
1120988126 14:90351902-90351924 AAATACAAACATATGGAGCTGGG + Intergenic
1125108400 15:36001623-36001645 CAGTACGTCCATATGTATCCAGG - Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133802898 16:9098398-9098420 AAGTAAATACATAAGTAGCTAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135292334 16:21250713-21250735 CAGAGCATACAAATGCAGCTGGG + Exonic
1138788984 16:59879974-59879996 TAGTAGATACATATATAGCATGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143718111 17:8789910-8789932 CAGTACATACTTATGAAGGAAGG + Intergenic
1143719590 17:8800068-8800090 CAGCACATACATATGGCTCTGGG - Intergenic
1143788735 17:9276416-9276438 AAGCACATACATCTGTAGCCTGG - Intronic
1144035983 17:11366433-11366455 CTTAACATACAAATGTAGCTGGG - Intronic
1144540362 17:16135365-16135387 CAGTACATCTTTATGAAGCTTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150832971 17:68540510-68540532 AAGTACACAAATATGTAGCAGGG - Intronic
1153917000 18:9754801-9754823 CAGTACATACAGTTGTCCCTCGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156267525 18:35501913-35501935 CAGTACATACATTTCTAGTAGGG + Intergenic
1158240348 18:55370384-55370406 CAGTACATAGGTAGGTAGGTAGG + Intronic
1158918101 18:62157162-62157184 AAGTAAATACACATGGAGCTGGG - Exonic
1159522118 18:69539568-69539590 CAGGAGATACATATGTATCCTGG + Intronic
1161926456 19:7303999-7304021 CAGGACATGTAGATGTAGCTTGG - Intergenic
1164397842 19:27881308-27881330 CAGTACAGACCTATGCAGCCAGG + Intergenic
1166641307 19:44497519-44497541 CAGTACATACACAGGTATTTGGG - Intronic
925344249 2:3159257-3159279 CAGTTCTTACATCTGTAACTGGG - Intergenic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
928898201 2:36289043-36289065 TAACACATACATTTGTAGCTTGG - Intergenic
929138859 2:38650006-38650028 CAGTCCTTAAAAATGTAGCTGGG + Intergenic
930167779 2:48220213-48220235 TAGTAGGTACATATGCAGCTTGG + Intergenic
933428658 2:82146046-82146068 CAGTGCATACTTATATTGCTTGG + Intergenic
935373192 2:102368759-102368781 AACTACCTACATATGTAGGTAGG - Intronic
936707773 2:115096081-115096103 GAGTACATACATGTGTACCTTGG - Intronic
937587868 2:123576825-123576847 CATTACATTCTTAAGTAGCTAGG - Intergenic
942377289 2:175350636-175350658 CAGCACACACATCTGTAGGTGGG + Intergenic
944028594 2:195203609-195203631 CAGTCCATACATATGGAACCAGG - Intergenic
944075207 2:195722029-195722051 CATTACATACATTAATAGCTAGG + Intronic
945747401 2:213735193-213735215 CAGCACCTACATATTTAGTTTGG - Intronic
1170985129 20:21250975-21250997 CAGAATATACATAAATAGCTGGG - Intergenic
1172294288 20:33797477-33797499 CTGGACATACATATGTATGTCGG - Intergenic
1173998047 20:47354745-47354767 CAGTACATAAATTTTCAGCTTGG - Intronic
1175112077 20:56655489-56655511 AAAAAGATACATATGTAGCTGGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
954617878 3:51979181-51979203 TAGCACATCCATCTGTAGCTTGG + Intronic
956139940 3:66136191-66136213 CAGCAGATACATATATAGATGGG - Intronic
963198117 3:142556373-142556395 TAGTACATACATAAGAATCTTGG + Exonic
963831102 3:150010535-150010557 AAGAAGATACATATGTGGCTGGG + Intronic
963838834 3:150083965-150083987 AAATATATACATATGTCGCTTGG + Intergenic
964542052 3:157790272-157790294 CAGCACATTTATATGTAGTTTGG - Intergenic
968332709 3:197885228-197885250 CAGCACATACACTTCTAGCTCGG + Intronic
968807220 4:2782193-2782215 CAGGTCATACATAGGTAGATAGG + Intergenic
972588597 4:40462124-40462146 CAGTGCAGACATTTGAAGCTAGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974157412 4:58092243-58092265 AAGAACATACATGTGAAGCTGGG - Intergenic
976242605 4:82974326-82974348 CAGTACATACATAAATACATTGG + Intronic
977163291 4:93663482-93663504 TAATACATACATATGTATTTTGG - Intronic
977631348 4:99247145-99247167 CAGAACATGCTTATTTAGCTTGG + Intergenic
977882840 4:102225545-102225567 CAGTACCTACAAATGAAGCAGGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978918563 4:114153518-114153540 CAGAACAGACATATGGATCTTGG + Intergenic
979270822 4:118759472-118759494 GAGTACATACATGTTAAGCTTGG - Intronic
980925317 4:139130764-139130786 AAGTACAGATATTTGTAGCTTGG + Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981617896 4:146661763-146661785 CAGTATAGACATATATAGCAAGG + Intergenic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
983412705 4:167419800-167419822 CAGTACAGACCTATGCAGCCAGG + Intergenic
984182453 4:176500548-176500570 AAAAACATATATATGTAGCTGGG - Intergenic
987416326 5:17665502-17665524 CAGTAGCTACATATGTATATGGG - Intergenic
987837901 5:23185662-23185684 CGGTAAATACATAAGTAGCAAGG + Intergenic
987860583 5:23482509-23482531 CATTACCTGCATATGTAGTTTGG + Intergenic
988600808 5:32638132-32638154 AAGTACATACATATTTACATTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
1000185606 5:158854954-158854976 CAGTACATTCATCTGTAGATGGG - Intronic
1000366660 5:160497640-160497662 CATTACATTCATATGTAGGTAGG - Intergenic
1004295455 6:14406025-14406047 AAGGACATAGATATGTAGGTAGG - Intergenic
1006975801 6:38099753-38099775 AAGTAAATACATATATACCTTGG - Intronic
1007438131 6:41832375-41832397 CAGTACATACATATGTAGCTAGG - Intronic
1007669713 6:43541375-43541397 CAGTACATACATATATTTATGGG - Intronic
1010656810 6:78521142-78521164 AAATATATATATATGTAGCTTGG - Intergenic
1015314292 6:131800560-131800582 CAGTAAAAACATAATTAGCTGGG - Intergenic
1019125001 6:169832333-169832355 GAGTACATACAAATGTAGAAAGG + Intergenic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1021290559 7:18838566-18838588 GAGTATATACATATATAGATGGG - Intronic
1021624905 7:22583480-22583502 CAGTGCCAACATATGTTGCTTGG - Intronic
1023140285 7:37094956-37094978 CAGGACAGACATATGTCCCTTGG + Intronic
1029897329 7:103997460-103997482 CAGTGCATACATATGAATGTGGG + Intergenic
1030972104 7:116072555-116072577 CAGAACATACTTTTGTGGCTGGG + Intronic
1039672195 8:39613575-39613597 CAGTACAGTCATTTGTAGGTAGG - Intronic
1041773354 8:61496738-61496760 CAGTACATACATATCTTGAAAGG + Intronic
1056059153 9:82864692-82864714 CATTTCAAACATATGTATCTGGG - Intergenic
1059777928 9:117494622-117494644 CAATTCAAACAAATGTAGCTTGG - Intergenic
1060543364 9:124446690-124446712 CAGTAAATACATATTTGGCCGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186682267 X:11887535-11887557 AAGTACAAACATATGTTGCAAGG - Intergenic
1187352472 X:18533576-18533598 CAGTAAATACATATTTAAGTTGG + Intronic
1188960438 X:36484766-36484788 CAGTAGATACAAATGTTGCCAGG + Intergenic
1190561455 X:51689991-51690013 CAGGACATACAATTCTAGCTAGG + Intergenic
1190562836 X:51703326-51703348 CAGGACATACAATTCTAGCTAGG - Intergenic
1191616479 X:63175338-63175360 CAGTACATAAATATATATCAAGG + Intergenic
1191619818 X:63203585-63203607 CAGTACATAAATATATATCAAGG - Intergenic
1192191523 X:68994184-68994206 CAGTCCTTACATCTCTAGCTCGG - Intergenic
1192999755 X:76551267-76551289 TAGTACAGACATATGCAGCCAGG - Intergenic
1193049174 X:77082976-77082998 CAGGGCATACATAAGTAGCAGGG + Intergenic
1193388539 X:80899406-80899428 CAGTACTTATATATGTAGGAAGG - Intergenic
1198460505 X:136858674-136858696 CAGTATATAGGTATGTAACTTGG + Intronic
1201762094 Y:17551659-17551681 CAGAACACACATATGTACCATGG + Intergenic
1201839458 Y:18354329-18354351 CAGAACACACATATGTACCATGG - Intergenic