ID: 1007447740

View in Genome Browser
Species Human (GRCh38)
Location 6:41920269-41920291
Sequence TCTTGGGTCTAGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007447740_1007447744 13 Left 1007447740 6:41920269-41920291 CCTTTTTTCCTCTAGACCCAAGA 0: 1
1: 0
2: 0
3: 24
4: 276
Right 1007447744 6:41920305-41920327 AAATTAGAAACAGACACAAGCGG No data
1007447740_1007447745 14 Left 1007447740 6:41920269-41920291 CCTTTTTTCCTCTAGACCCAAGA 0: 1
1: 0
2: 0
3: 24
4: 276
Right 1007447745 6:41920306-41920328 AATTAGAAACAGACACAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007447740 Original CRISPR TCTTGGGTCTAGAGGAAAAA AGG (reversed) Intronic
900844092 1:5082312-5082334 TGTGGGGTTTAGAGGAAACACGG + Intergenic
903846375 1:26281909-26281931 GCATGGGTCTAGTGGCAAAATGG + Intronic
905014577 1:34768567-34768589 TCTAGGTGCTAGAGGATAAAAGG - Intronic
910057877 1:83053282-83053304 TCCTGGGTCTAAAGAAACAATGG - Intergenic
910118192 1:83755982-83756004 TCTTGGGGCTTGAGGAGCAAGGG + Intergenic
910348644 1:86270442-86270464 TGTAGGGTCAAGAGGTAAAATGG - Intergenic
912071016 1:105809801-105809823 TTATGGGTCTAGAAGCAAAAAGG + Intergenic
912445965 1:109736932-109736954 TCTTGGGTATAAAGGCTAAAAGG - Exonic
912705765 1:111910771-111910793 TCTTCGTTCTACAGGAGAAATGG - Intronic
912811177 1:112795750-112795772 TCTTGCCTCTAGAGGAAGGAAGG + Intergenic
913333668 1:117687646-117687668 TCCTGGGTCTAAGGGCAAAAGGG + Intergenic
914319698 1:146547055-146547077 TCTTGGATCTACGGGAGAAATGG + Intergenic
914353380 1:146859976-146859998 TCTTGGGTCTAAAGGAGCAAGGG + Intergenic
914402352 1:147334385-147334407 TCGTGGTTCTATAGGAAAATGGG + Intergenic
914509976 1:148323254-148323276 TCTTCTGTCTAGAGGAAGAGGGG - Intergenic
915621971 1:157091661-157091683 CCTGGGGTGTAGAGGAAAAGGGG + Intergenic
916444474 1:164859406-164859428 ACTTGGGTGCAGAGGATAAATGG - Intronic
916590792 1:166188225-166188247 TCTCGGGTTTGGAGGAAAAATGG - Intergenic
916965690 1:169940087-169940109 AATGGGGTCTAGAGTAAAAATGG + Intronic
917567146 1:176224571-176224593 TCCTGTCTCTAGAGAAAAAATGG + Intergenic
917941029 1:179921736-179921758 TCTGGGGTGTAGAGTACAAAGGG - Intronic
918174888 1:182035141-182035163 TATTGGGTGAAAAGGAAAAAAGG + Intergenic
918807890 1:189073075-189073097 TCTTTGTTCTGCAGGAAAAAAGG + Intergenic
919103793 1:193124386-193124408 ACATTGGTTTAGAGGAAAAATGG + Intronic
919185838 1:194148115-194148137 ACTTGATTCTAGAGGTAAAATGG + Intergenic
920871610 1:209799599-209799621 GCTTGGGGCTTGAGGAAAATTGG - Intronic
922323093 1:224504574-224504596 GCTGGGCTCTAGAGGAAACATGG - Intronic
923176544 1:231472049-231472071 TCTTGGGTATTGTGGAAAAAAGG + Intergenic
923914402 1:238485926-238485948 TTTTGGGTGAAAAGGAAAAATGG + Intergenic
1063323944 10:5078541-5078563 TCTTGGGTCAAATGAAAAAAGGG + Intronic
1063588167 10:7371748-7371770 TCTTGTTTCTAGAAGATAAATGG - Intronic
1064774912 10:18765765-18765787 TCTTGGTACTAGAGGAAGAAGGG + Intergenic
1064878341 10:20020802-20020824 TCTTGGGTATAAGGAAAAAAAGG - Intronic
1064885075 10:20102782-20102804 TATAATGTCTAGAGGAAAAATGG + Intronic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1067824944 10:49564223-49564245 GATTGGGTCTTGAGGAGAAAGGG + Intergenic
1067847761 10:49737085-49737107 TCTGGGGTAGAGAGGACAAATGG + Intronic
1068856109 10:61798871-61798893 TCTTTGGTGGAGTGGAAAAAGGG - Intergenic
1069214552 10:65803472-65803494 TGGAAGGTCTAGAGGAAAAATGG + Intergenic
1071164347 10:82787078-82787100 GCATGTGTCTAGAGGGAAAATGG - Intronic
1071284484 10:84131838-84131860 TGTTGGTCCTAGAGGAACAATGG - Intergenic
1072970593 10:100013914-100013936 TCTTGAGGCTACAGAAAAAATGG - Intergenic
1075408127 10:122208045-122208067 ACTAGGGCCTAGAGGAAACAGGG + Intronic
1076160037 10:128236672-128236694 TCTTGGGGGTAGGGGAAATATGG - Intergenic
1076267696 10:129121667-129121689 TCTTTGGTCTTTAGGTAAAATGG - Intergenic
1077880913 11:6349352-6349374 TCTTGGATACAGAGGAAAGAAGG - Intergenic
1078397005 11:10989972-10989994 TCTTGGGGCAGGAGGAAAAGGGG + Intergenic
1079653254 11:22957678-22957700 TCTTTGGTCAAGAGGATATAAGG - Intergenic
1080219632 11:29886311-29886333 GTTTGTGTATAGAGGAAAAATGG - Intergenic
1081184835 11:40029388-40029410 TCTTAGATCTTGAGGAAAACTGG - Intergenic
1081819112 11:45974301-45974323 TCCTGGGTTTAGATGACAAAAGG + Intronic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1082938064 11:58674977-58674999 TATTGGGTGAAAAGGAAAAATGG - Intronic
1085942790 11:81225502-81225524 TCTTGCATCAAGAGGGAAAATGG + Intergenic
1086844485 11:91731263-91731285 TCTTAGATCTTGAGGAAAACCGG + Intergenic
1086974514 11:93116858-93116880 TATTGGGTGAAAAGGAAAAAAGG - Intergenic
1087495898 11:98890542-98890564 TCTGGGGTCTGGAGGACAATGGG + Intergenic
1088926888 11:114311964-114311986 TCTTGGGTCAAGGCTAAAAATGG - Intronic
1091212155 11:133871315-133871337 TTATAGGTCTAGAAGAAAAAAGG - Intergenic
1092136839 12:6155377-6155399 TGTTAGGGCTAGAGAAAAAAAGG + Intergenic
1092198959 12:6568186-6568208 TGGTGGGTCTAGAGGAAATTGGG - Exonic
1093753416 12:22827145-22827167 TCCTGGGTCTGGAAAAAAAAGGG - Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1094646739 12:32331973-32331995 TCTGGGGTACAGGGGAAAAAAGG + Intronic
1097459001 12:59836699-59836721 TCCTGGGGCTGGAGGAGAAAAGG - Intergenic
1102618482 12:114175188-114175210 TCTGGGGTCTAGACAGAAAAAGG - Intergenic
1103727208 12:123003910-123003932 TTTTGGGACTAGTGGGAAAATGG + Intronic
1106046972 13:26151778-26151800 TCTGAGGACTAGAAGAAAAAAGG + Intronic
1107998545 13:45885832-45885854 CCTTGGGGCTAGAGGAGAAGAGG + Intergenic
1109865868 13:68261609-68261631 TATTGGGTGAAAAGGAAAAATGG - Intergenic
1111527580 13:89492279-89492301 TCTGGGGTCTGGAGGACAGATGG + Intergenic
1112192468 13:97191390-97191412 TATTGGGTGAAAAGGAAAAAAGG - Intergenic
1112691631 13:101902492-101902514 TCTTGTTTCATGAGGAAAAATGG - Intronic
1113831745 13:113300987-113301009 TCTTGGGTACAGAGAAGAAAGGG - Intronic
1114237004 14:20832640-20832662 TCATCGGTGTAGAGGGAAAAAGG + Intergenic
1114677391 14:24452646-24452668 TATTCGGTCAAGTGGAAAAAAGG - Intergenic
1115900575 14:38142961-38142983 TTTTAGGTCTAGAGCAAAGATGG + Intergenic
1116099746 14:40418239-40418261 TCTTGGGTCCAGAGAACAAAAGG - Intergenic
1116162164 14:41281759-41281781 GCTTTGGTCTAGGGGAATAATGG + Intergenic
1116997192 14:51336182-51336204 TCTGGGTTCTGCAGGAAAAAAGG + Intergenic
1117395260 14:55302766-55302788 TCTTGGGTTTAGAGAAGAATTGG + Intronic
1118378567 14:65198711-65198733 TTTTGGGGCTAGAGGAAACTTGG + Intergenic
1118704971 14:68471998-68472020 TCTGGGGACCAAAGGAAAAATGG - Intronic
1119615321 14:76095209-76095231 CCTTGAGTCTAGAGGCAAAATGG + Intergenic
1124809449 15:32920393-32920415 CCTTGGTTGTAGAGGAAGAATGG - Intronic
1124875413 15:33587608-33587630 TCTTGGTTCTAGAAGATTAAAGG - Intronic
1125141050 15:36408165-36408187 TCTTCGGACTAGAGACAAAAAGG + Intergenic
1126212901 15:46119912-46119934 GCTTGGGGAAAGAGGAAAAAAGG + Intergenic
1126257810 15:46648683-46648705 TATTTTGTCTAAAGGAAAAAGGG + Intergenic
1127322107 15:57856814-57856836 TCTTGTGCCTTGAGGAAAAGGGG + Intergenic
1129001071 15:72334503-72334525 ACTTGGGGCTATAGGAAGAAAGG - Intronic
1129224711 15:74162229-74162251 TCGTGTCTCAAGAGGAAAAAAGG + Intergenic
1129389340 15:75212808-75212830 TCTTGGGCCTATATGAACAATGG - Intergenic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1129798246 15:78394354-78394376 TCTTGGGGCTAGTGCAAACAGGG - Intergenic
1130044040 15:80430330-80430352 TCTGGAGTCTGGAGGAAAAGTGG - Intronic
1130880129 15:88047799-88047821 CCTTTGGTCTGGATGAAAAATGG + Intronic
1131199241 15:90382752-90382774 TTTTACTTCTAGAGGAAAAAAGG - Intergenic
1131735153 15:95324232-95324254 TCTTGTTTCTAGATGAAAATTGG - Intergenic
1135050941 16:19192548-19192570 TCCTGTTTCTACAGGAAAAAGGG + Intronic
1138839997 16:60489000-60489022 ACTTGGTTCTATAGGAAAAAAGG + Intergenic
1139980643 16:70855542-70855564 TCTTGGGTCTAAAGGAGCAAGGG - Intronic
1140013830 16:71163020-71163042 TCTTGGATCTACAGGAGAAATGG - Intronic
1141258434 16:82426851-82426873 TCTTTTTTCCAGAGGAAAAAAGG + Intergenic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144466083 17:15498863-15498885 TGCTGAGTCTAGAGGGAAAATGG + Intronic
1145266818 17:21383556-21383578 TCTTGGGTCTTGTGGAAATAGGG + Intronic
1146618857 17:34380456-34380478 TTTTGGGACAAGAGGGAAAAGGG - Intergenic
1150346581 17:64409311-64409333 TCTTTGGTCTAGAACAAAGATGG + Intronic
1151508097 17:74542409-74542431 TCTGGGGTCTGGAGGAAGAAGGG - Intronic
1151551015 17:74822532-74822554 TCTTGGATCAAAAGGAAAAGAGG - Intronic
1152210664 17:79001447-79001469 TGTGGGGTCTGGAGGTAAAATGG - Intronic
1153174137 18:2351571-2351593 TCTTAGATCTTGAGGAAAACCGG + Intergenic
1154977375 18:21473043-21473065 ACTTGGGTCTGGAGGAAAATGGG + Exonic
1161815043 19:6494796-6494818 TTATAGGTCTAGAGGTAAAATGG + Exonic
1161918017 19:7244635-7244657 TCTTGGGACAAATGGAAAAATGG - Intronic
1163916440 19:20244662-20244684 TCTTGTCTCTAGAGAAAAATGGG + Intergenic
1164903476 19:31947789-31947811 TTTTGGCTCTAGAAGAGAAAGGG + Intergenic
1165283568 19:34818023-34818045 TTTTGGGCCTGGAGGAAAAAAGG + Intergenic
1165293871 19:34910231-34910253 TCTTGGGCCTGTAGAAAAAAAGG + Intergenic
1165987581 19:39784064-39784086 TCTTAGGTCTAGTGGATAAAAGG + Intronic
1166158416 19:40933155-40933177 TCTTGGGGGTAGGGGAAAGAGGG + Intergenic
1167152676 19:47718980-47719002 TCCTGGGTCTAGAGGAGGAGGGG + Intronic
1167248813 19:48390262-48390284 TCTTGGGTCTGAGGGAAGAAGGG - Intronic
1167668890 19:50838679-50838701 TCCTGGGTCTCAAGGAAGAAGGG + Intergenic
1168722413 19:58561407-58561429 CCTTAGGACTAGAGGAACAAAGG - Intergenic
924973984 2:156535-156557 AGCTGGGTATAGAGGAAAAACGG + Intergenic
925788084 2:7452554-7452576 TCTTTTGTCTTGTGGAAAAATGG - Intergenic
926473124 2:13286277-13286299 TCTTGTGTGTAGGGTAAAAAGGG - Intergenic
927160872 2:20259443-20259465 TACTGGGCCTAGAGGAAGAAGGG - Intronic
927437579 2:23082661-23082683 ACTTGAGTCCACAGGAAAAAAGG - Intergenic
928897874 2:36285233-36285255 GCTTTGGTCTAGGGTAAAAAAGG + Intergenic
929756786 2:44772724-44772746 TATTGTGTCCAGAGGACAAACGG - Intergenic
931572566 2:63684270-63684292 ACTTGGGCCTACAGCAAAAAGGG - Intronic
931691009 2:64834934-64834956 TCTTCAGTCTAGTGGCAAAACGG + Intergenic
931836998 2:66109478-66109500 TCTTTGGACTGGAGGGAAAATGG + Intergenic
932088355 2:68782368-68782390 TCTAGGGTCCAGAAGTAAAATGG - Intronic
936708069 2:115099543-115099565 TCTTGGTTCTAGAGGTTTAAAGG - Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940123703 2:150298068-150298090 TCTTGGGGCAAAAGGGAAAAGGG + Intergenic
940717306 2:157241309-157241331 TCTTGGGGCAAACGGAAAAAGGG + Intergenic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
941613304 2:167688696-167688718 TCTTAGAACTAGAGAAAAAAGGG + Intergenic
941636219 2:167937487-167937509 TCTTGGGTCTTGAAAATAAAGGG - Intergenic
942483234 2:176412140-176412162 TCTTGGCTTTAGAGTCAAAAGGG + Intergenic
944223715 2:197328245-197328267 TCTTGGGGCTTGAGGAATTAGGG - Intergenic
945032201 2:205676136-205676158 GCTTTGGACTAGAGGAAAGAGGG + Intergenic
945857820 2:215089799-215089821 TCTAGTGTTTGGAGGAAAAAAGG - Intronic
946759730 2:222981595-222981617 TCTTTGGGCAAGAGAAAAAATGG - Intergenic
948007165 2:234619044-234619066 TTTTTGGTCTAGAGGAAGATGGG - Intergenic
948913902 2:241020511-241020533 TCTTGGATTTACAAGAAAAATGG - Intronic
1170222369 20:13953728-13953750 TATTGGGTGAAAAGGAAAAAAGG - Intronic
1171340985 20:24428983-24429005 TCTAGGTGCTAGAAGAAAAAAGG + Intergenic
1172234994 20:33365975-33365997 ACTTGGGGCTAGAGAATAAATGG - Intronic
1173173295 20:40744351-40744373 TCATGGTTTAAGAGGAAAAATGG - Intergenic
1173330737 20:42074357-42074379 TCTTGGATGTGGAGGAGAAAGGG - Exonic
1173686301 20:44925671-44925693 CCTTGTGTTTGGAGGAAAAAAGG + Intronic
1177428936 21:20963867-20963889 TCTTTAGTGTAGAAGAAAAAGGG + Intergenic
1177671225 21:24231197-24231219 AGTTTTGTCTAGAGGAAAAAGGG + Intergenic
1180672958 22:17567570-17567592 CGTTGGGTCTAGATGAAACAGGG - Intronic
1181888736 22:26042370-26042392 GGATGGGTCTAGAGGAAGAAGGG - Intergenic
1183527910 22:38334958-38334980 TCATGGGTCTGGCAGAAAAAGGG - Intronic
1184328957 22:43813498-43813520 TTTTGGGGCAAGAGGAAAAGAGG - Intergenic
1185273218 22:49938028-49938050 TATTGTGTCCAGAGGAGAAAAGG + Intergenic
1185414692 22:50703685-50703707 TCCTGGGTCCAGAGGTAAGAAGG - Intergenic
950132599 3:10557576-10557598 TCTTGGGAACAGAGGAGAAACGG + Intronic
950623946 3:14230670-14230692 TGTGGGGTCAAGAGGGAAAACGG - Intergenic
951262464 3:20526633-20526655 TCTTAGGTCAAAAGAAAAAAAGG - Intergenic
951750632 3:26031259-26031281 CCTTGGGTCTTGGGGAAAGATGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
953008494 3:39000616-39000638 TCTTGAGTTTAGAGGAAGAAAGG - Intergenic
954614659 3:51963574-51963596 TCTTGTGGCTCCAGGAAAAATGG + Intronic
956696152 3:71921053-71921075 TCCTGGGTCTGGGGGAACAAGGG - Intergenic
957999069 3:87728927-87728949 TCTTAGGACTAGAGGAGAAGAGG - Intergenic
958462482 3:94417122-94417144 TCATGGGCCTAGAGATAAAATGG + Intergenic
959609239 3:108275849-108275871 TCTTAGATCTTGAGGAAAACCGG + Intergenic
959814350 3:110658092-110658114 ACTTGGATCTGAAGGAAAAAAGG - Intergenic
960737923 3:120800910-120800932 TCTTGGGACATGAGGAAAAAAGG + Intergenic
964246572 3:154660606-154660628 ACTTGGGAGTAGAGGATAAAAGG + Intergenic
966976645 3:185090243-185090265 TCTTGGTTGTAGAGCACAAAGGG + Intronic
967197615 3:187042402-187042424 TCATGGCTCAAGAGGAAGAAGGG + Intronic
967293737 3:187945997-187946019 TCATGGGGATAGAGGAGAAAAGG - Intergenic
967622398 3:191649833-191649855 TCTTAGATCTTGAGGAAAACTGG - Intergenic
967630291 3:191737494-191737516 TATTGGGTGAAAAGGAAAAAAGG + Intergenic
970485616 4:16521702-16521724 TCCTGGGGCTAGAAGAACAAAGG - Intronic
970756448 4:19432575-19432597 ACTTGGGTCTACAGAAAGAAGGG + Intergenic
971498337 4:27291857-27291879 CCTTGGATTTAGGGGAAAAAAGG - Intergenic
972070414 4:35012583-35012605 TCTTGTCTCTATAGGAAAGAGGG - Intergenic
972272181 4:37522396-37522418 CCTTGGGTCTTAAGGAAACATGG - Intronic
973297299 4:48538873-48538895 CATTGAGTCTGGAGGAAAAAAGG - Intronic
974159011 4:58112995-58113017 TATTGGGTGAAAAGGAAAAATGG + Intergenic
976636007 4:87287037-87287059 TCTGGGGTCTGGAGGACAATGGG - Intergenic
977215655 4:94280305-94280327 TCTGGGGTATAGATGAAACAAGG - Intronic
978459163 4:108930858-108930880 TTTTAGGGCAAGAGGAAAAATGG - Intronic
979507513 4:121514846-121514868 TATTGGGTGAAAAGGAAAAAAGG - Intergenic
980392354 4:132163069-132163091 TCTTAGATCTTGAGGAAAACTGG - Intergenic
980435983 4:132774434-132774456 CCTTGGGACTAGAGGAGGAATGG - Intergenic
980951553 4:139383908-139383930 ACTTGGGTATAGAGGAAGATAGG + Intronic
981126390 4:141111526-141111548 ACTTGTGTTCAGAGGAAAAAAGG + Intronic
982751535 4:159167728-159167750 TCTTGGCACAAGAAGAAAAAAGG + Intronic
984512800 4:180699140-180699162 TATTGGGTGAAAAGGAAAAAAGG - Intergenic
984896910 4:184549103-184549125 TATTGGGTGAAAAGGAAAAAAGG + Intergenic
986352299 5:6891731-6891753 TATTGGGTGAAAAGGAAAAAAGG - Intergenic
986434664 5:7717142-7717164 ACTTGGTTCTATATGAAAAATGG - Exonic
986436909 5:7743233-7743255 TCCTGGGTCAACAGGAACAAGGG + Intronic
987452454 5:18103166-18103188 ACTTGGGTATAAAGGAGAAAAGG + Intergenic
988658324 5:33237061-33237083 TCTTAGGTCTGGAGGAGCAAGGG + Intergenic
992662957 5:78979645-78979667 TATTGGGTGAAAAGGAAAAAAGG - Intronic
996752188 5:126900101-126900123 TCTGGTGTCAAGAGGAAATAAGG + Intronic
996877723 5:128258196-128258218 TCTTGGGTTGAGAAGAATAATGG + Exonic
997150953 5:131494572-131494594 TCTAGGGTACACAGGAAAAAGGG + Intronic
997248474 5:132370741-132370763 TCAAGAGACTAGAGGAAAAACGG - Intronic
997414105 5:133711836-133711858 CCTTGGGCTTAGAGGAAAAATGG + Intergenic
998269677 5:140695369-140695391 CCTTGGGGATAGTGGAAAAAAGG + Intronic
998722641 5:144972247-144972269 TCTTGGGTCTAGAGCTCAATGGG - Intergenic
1003884741 6:10511508-10511530 TCTCTGGTATAGAGGAAAGAAGG + Intronic
1005067584 6:21833623-21833645 TCTTAAGTATAGAAGAAAAAGGG - Intergenic
1006155600 6:32011371-32011393 CCTGGGGACTAGAGGAAAAGGGG - Intergenic
1006161931 6:32044225-32044247 CCTGGGGACTAGAGGAAAAGGGG - Intronic
1006234506 6:32616846-32616868 TCTTAGATCTTGAGGAAAACTGG - Intergenic
1006315424 6:33288687-33288709 TCTTGGGTCTAGGGGAAAGGAGG + Exonic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1007593185 6:43035819-43035841 TTTGGAGTCTAGGGGAAAAAAGG - Intergenic
1007715219 6:43851843-43851865 TCTTGGGTCTAAAGGAATGGGGG - Intergenic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1009763711 6:68040493-68040515 TCTTAGATCTTGAGGAAAACTGG + Intergenic
1011797437 6:90972263-90972285 TCCTGGGTCAATAGGAAAAGAGG - Intergenic
1012487175 6:99735315-99735337 ATCTGGGTCTAGAGGATAAAGGG + Intergenic
1013248348 6:108310024-108310046 CCATGGGACTTGAGGAAAAAGGG - Intronic
1013296173 6:108760240-108760262 TCTTGGGCCTGGAGGGTAAAGGG + Intergenic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1014674689 6:124349167-124349189 TATTGGGTGCAAAGGAAAAAAGG + Intronic
1015267245 6:131301225-131301247 TCTTGGGTGAAAAGGAAAAGAGG - Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1019187907 6:170231719-170231741 TCTGGGGTGGGGAGGAAAAAGGG - Intergenic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1022892919 7:34719341-34719363 CCTTGTGTCTAAATGAAAAAAGG - Intronic
1022977248 7:35570082-35570104 GCTTGGGATTAGAGGAAATAGGG + Intergenic
1023258630 7:38336373-38336395 TCTTAGATCTTGAGGAAAACCGG + Intergenic
1025864558 7:65368721-65368743 TCTGGGTTCTAGAGTATAAAGGG - Intergenic
1026383503 7:69822501-69822523 TCTAGAATCTAGAGCAAAAAGGG - Intronic
1028205572 7:88012960-88012982 CCTTGGCTCTAGAGGGAAAGAGG - Intronic
1028278606 7:88892039-88892061 TCTTTGGTTTAGAAGAAAGATGG - Intronic
1028741734 7:94283174-94283196 TCTTAGGTATAGAAGAACAAGGG - Intergenic
1031172038 7:118304171-118304193 TATTGGGTGAAAAGGAAAAAAGG + Intergenic
1031275199 7:119712520-119712542 TCTAGGGTCTGGAGGACAGATGG + Intergenic
1032553038 7:132803741-132803763 TATTGGAACTAGAGGAGAAAGGG + Intronic
1033029133 7:137807915-137807937 TATTCGCTCTGGAGGAAAAATGG - Intronic
1034285700 7:149881866-149881888 TCTTGGGGGTAGAGGACAATGGG - Intergenic
1034888842 7:154821374-154821396 TGTTGGATCTAGTGGCAAAAAGG - Intronic
1037027036 8:14051559-14051581 TCTCTGGTCTACATGAAAAAGGG + Intergenic
1039339910 8:36636448-36636470 CCTTGAGTCTAGAAGACAAACGG - Intergenic
1041422834 8:57688682-57688704 TCTTGGGACTAGGAGCAAAATGG - Intergenic
1042067943 8:64899548-64899570 TTATAGGTCTAGAAGAAAAAAGG - Intergenic
1042280534 8:67051549-67051571 TCTGGGCTCTACAGAAAAAAAGG - Intronic
1043269124 8:78307165-78307187 TATTGGGCCTAGAGGACAGATGG - Intergenic
1044018839 8:87079017-87079039 TCCTGGGTCTAGAAAAAAAGGGG - Intronic
1044344280 8:91086247-91086269 TATTGGGTTTATATGAAAAATGG + Exonic
1044476201 8:92629319-92629341 TCCTGAGTTTAGAGGAAAAATGG - Intergenic
1045928440 8:107597663-107597685 TCTTAGATCTTGAGGAAAACTGG + Intergenic
1046337828 8:112813352-112813374 TCTTAGATCTTGAGGAAAACCGG + Intronic
1046762788 8:118038875-118038897 TGTTGGATCTATAGGAAAAGAGG - Intronic
1047116000 8:121842504-121842526 TCTGGGGTCTGGAGGACAATGGG - Intergenic
1048493098 8:134912864-134912886 TCTTGGGTCTTTGGGAAACAGGG - Intergenic
1050800935 9:9613527-9613549 TCTTGGCTCTAAAAGAAGAAGGG - Intronic
1052151747 9:25125956-25125978 TCATGGGTCTAGAAGCAAACAGG + Intergenic
1052247129 9:26349270-26349292 TCTTAGATCTTGAGGAAAACCGG - Intergenic
1052853644 9:33393560-33393582 TCCAGGGTCTAGAGAAAGAAGGG - Intronic
1053681667 9:40489714-40489736 TCCAGGGTCTAGAGAAAGAAGGG - Intergenic
1054282046 9:63135220-63135242 TCCAGGGTCTAGAGAAAGAAGGG + Intergenic
1054294760 9:63325231-63325253 TCCAGGGTCTAGAGAAAGAAGGG - Intergenic
1054392779 9:64629718-64629740 TCCAGGGTCTAGAGAAAGAAGGG - Intergenic
1054427429 9:65134927-65134949 TCCAGGGTCTAGAGAAAGAAGGG - Intergenic
1054502948 9:65886613-65886635 TCCAGGGTCTAGAGAAAGAAGGG + Intronic
1055273176 9:74584783-74584805 TCATGGAGCTATAGGAAAAAGGG + Intronic
1056605927 9:88084831-88084853 TCTTGGGTTTTCGGGAAAAAGGG + Intergenic
1056700748 9:88904978-88905000 TCTTGGGGCAAATGGAAAAAGGG - Intergenic
1058004539 9:99901624-99901646 TCTGGGGTCTAGAGGACTAGAGG + Intergenic
1058909028 9:109504295-109504317 TCTTGGGACTAGAGGATGAAGGG - Intergenic
1059709288 9:116852698-116852720 TCATAGGTCTTGAGGATAAATGG - Intronic
1060836011 9:126755611-126755633 TCTTTGGTATAGAAGAAAGACGG + Intergenic
1061515183 9:131085657-131085679 TCTTGGCACTGGAGGAAAGAGGG - Exonic
1188164980 X:26851187-26851209 TTTTGGGTCTATAGATAAAAGGG - Intergenic
1192207647 X:69106908-69106930 TCTTGGGGCTTTAGGAATAAGGG - Intergenic
1192945966 X:75965960-75965982 TCATTGGTATAGAGGAATAAAGG + Intergenic
1193462300 X:81806003-81806025 TCTTAGATCTCGAGGAAAACAGG + Intergenic
1193463026 X:81812084-81812106 TCTTAGATCTTGAGGAAAACAGG + Intergenic
1193665449 X:84310306-84310328 CCTTGGGCCTTGAGGAAACATGG + Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic
1197575662 X:128208055-128208077 TCTTAGGTCTTGAGGAAAACCGG - Intergenic
1197575897 X:128211015-128211037 TCTTAGATCTTGAGGAAAACCGG - Intergenic
1198498695 X:137220579-137220601 TATTGGGTGAAAAGGAAAAAAGG - Intergenic
1198508821 X:137328496-137328518 TCTTGGTTCTAGAGGTACAGTGG - Intergenic
1199077290 X:143537832-143537854 TCTTGGGGCAAAAGGGAAAAGGG - Intergenic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic