ID: 1007449885

View in Genome Browser
Species Human (GRCh38)
Location 6:41934887-41934909
Sequence CTGCACTGTATGAGGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007449885 Original CRISPR CTGCACTGTATGAGGTAAGG AGG (reversed) Intergenic
900497737 1:2983815-2983837 GTGCACTGTATTAGCTAATGCGG + Intergenic
900810314 1:4796843-4796865 CTGTACTGCAGGAGGGAAGGAGG + Intergenic
901536973 1:9888903-9888925 CTGTATTGAATGAGGTCAGGTGG - Intronic
902263055 1:15241404-15241426 CAGCACTGTGGGAGGTGAGGCGG + Intergenic
902381686 1:16055745-16055767 CTTCCCTGCATGAGGTAACGGGG + Exonic
907951759 1:59189942-59189964 CTGCCCTGTATGAGGAAATGAGG - Intergenic
908720949 1:67125408-67125430 CTGAACTGGACGAGGTGAGGTGG + Intronic
909508140 1:76418352-76418374 CTACACTGTGTGTGTTAAGGCGG - Intronic
910173896 1:84407283-84407305 CTGCATTGAATGTGGTAAGGAGG - Intronic
910685051 1:89907436-89907458 CAGCACTTTGTGAGGTTAGGTGG - Intronic
911612580 1:99972582-99972604 CAGCACTTTAGGAGGTGAGGTGG - Intronic
912795205 1:112689175-112689197 CTGCAGGGTGTGAGGGAAGGGGG + Intronic
913187202 1:116379818-116379840 CTTCAATGTAAAAGGTAAGGGGG - Intronic
918401250 1:184164726-184164748 CTGCAGTGTCTGTGGTAAGAAGG + Intergenic
919517234 1:198540893-198540915 CTCTTCTGTATGAGATAAGGAGG + Exonic
919531051 1:198720575-198720597 CAGCACTTTGGGAGGTAAGGTGG - Intronic
919935892 1:202250650-202250672 CAGCACTGTAGGAGGCGAGGTGG - Intronic
1065422371 10:25559886-25559908 CTGATCTGTAACAGGTAAGGTGG + Intronic
1069338748 10:67385943-67385965 CTGCACTGTATGTGACCAGGAGG - Intronic
1070080808 10:73185299-73185321 CAGCACTTTGGGAGGTAAGGAGG + Intronic
1070660868 10:78304341-78304363 CTCCACTGTATGATGTTGGGGGG + Intergenic
1072559507 10:96557991-96558013 AAGCACTGTATTAGGTAAGTAGG - Intronic
1074766965 10:116706652-116706674 CTGCCCTGTATGAGGAAAGATGG - Intronic
1075988841 10:126815204-126815226 CTGCACTTTGGGAGGCAAGGTGG + Intergenic
1077430839 11:2515382-2515404 CTGCCCTGTGTGAGGGAGGGCGG + Intronic
1078383019 11:10861141-10861163 CAGTAATGTATTAGGTAAGGAGG + Intergenic
1079498872 11:21078715-21078737 CTGCAATATATGAGAGAAGGTGG + Intronic
1080459925 11:32445419-32445441 CAGCACTGTGGGAGGTCAGGCGG + Intergenic
1081423852 11:42903503-42903525 CTGCACTCCAAGAGGAAAGGGGG + Intergenic
1085650365 11:78262421-78262443 CTGCACTGTGGGAGGTAACCTGG + Intronic
1085950182 11:81321224-81321246 CTAAGCTGTATGAGGTGAGGAGG - Intergenic
1091358027 11:134953384-134953406 CTGAACTGTAGCAGGTCAGGTGG - Intergenic
1093035148 12:14325730-14325752 CTGCACTTTCAGAGGCAAGGTGG + Intergenic
1093854501 12:24084018-24084040 CTGCAGTGCAAGAGGAAAGGAGG + Intergenic
1094573739 12:31664860-31664882 CAGCACTTTAGGAGGCAAGGTGG - Intronic
1099207149 12:79741960-79741982 CAGCACTTTGTGAGGTTAGGTGG + Intergenic
1101911595 12:108864046-108864068 CAGCACTTTGGGAGGTAAGGCGG + Intronic
1102067100 12:109986175-109986197 CTTCACAGAATGAGTTAAGGAGG - Intronic
1102901069 12:116637503-116637525 CCGCACTTTGTGAGGCAAGGTGG - Intergenic
1103389220 12:120558816-120558838 CAGCACTTTGGGAGGTAAGGCGG - Intronic
1103560641 12:121791793-121791815 CTGCCCTGCAAGAGGTCAGGAGG - Intronic
1104689854 12:130817873-130817895 CTTCACTGAAGGAGGTAAGAAGG + Intronic
1105782234 13:23715443-23715465 CTGCACTGTGCATGGTAAGGGGG + Intergenic
1115931436 14:38500760-38500782 CTTCACAGAATGAGTTAAGGAGG + Intergenic
1116220488 14:42079771-42079793 CTGCCCTGTATTAGGTAATGAGG - Intergenic
1116835372 14:49765188-49765210 CAGCACTTTAGGAGGTGAGGCGG - Intergenic
1117494953 14:56293842-56293864 CTGCCCTGCAGGAGGAAAGGGGG + Intronic
1118345530 14:64938060-64938082 CTGCACTGGATGAGGAATTGGGG + Intronic
1118531019 14:66705297-66705319 CTTCACTGAATGAGTTAGGGAGG - Intronic
1118916760 14:70114198-70114220 CAGCACTGTAAGATGTCAGGTGG - Intronic
1120023947 14:79560924-79560946 GTGCACAGTATGATGGAAGGGGG - Intronic
1121498099 14:94411520-94411542 CTGCACTCTCTGAGGTAGTGGGG - Intergenic
1121588297 14:95079052-95079074 CAGGACTGGATGAGGAAAGGTGG + Intergenic
1121874729 14:97440828-97440850 CTGTATTGTATCAGGGAAGGAGG + Intergenic
1125027657 15:35046652-35046674 CAGCACTTTGGGAGGTAAGGCGG - Intergenic
1125369701 15:38959893-38959915 CTTCACAGTATGAGGTATGAAGG + Intergenic
1125621555 15:41067320-41067342 CAGCACTTTAGGAGGTGAGGCGG - Intronic
1128300807 15:66565379-66565401 CTGCACTTTTTCAGGTATGGGGG - Exonic
1133096327 16:3449123-3449145 CAGCACTTTAGGAGGTGAGGCGG + Intronic
1133096692 16:3451965-3451987 CAGCACTTTGGGAGGTAAGGTGG + Intronic
1133096793 16:3452706-3452728 CAGCACTTTGGGAGGTAAGGTGG + Intronic
1135822575 16:25697146-25697168 GTGCACTGTATTAGGTACTGGGG + Intronic
1136429178 16:30186983-30187005 CTGCAGTGGATGAGGGCAGGAGG + Intronic
1137263173 16:46847334-46847356 CTACACTGGCTGAGGTCAGGTGG + Intergenic
1138714888 16:59009634-59009656 CAGCACTGTCTGAGGTAGTGGGG + Intergenic
1138914572 16:61447765-61447787 CTGCACAGCAGGAGGTAAGGGGG - Intergenic
1142919621 17:3172795-3172817 CTCCTCTGTCTGAGGAAAGGTGG + Intergenic
1143254683 17:5546969-5546991 CTCCTCTGTATCAGGTAAGCCGG - Intronic
1143402259 17:6654038-6654060 GTGCACTGTAGGATGTCAGGTGG - Intergenic
1145828429 17:27895180-27895202 ATGCACTGTCTGACATAAGGGGG - Intergenic
1148273335 17:46281227-46281249 CTGCACTCTATGAGGGGTGGGGG - Intronic
1149333612 17:55611079-55611101 CAGTACTGTATGAGGGAGGGAGG - Intergenic
1149483432 17:57022334-57022356 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1149682721 17:58517366-58517388 CTGCACTGCCTGAGGAAAGCAGG - Intronic
1150409721 17:64933334-64933356 CTGCACTCTATGAGGGGTGGGGG + Intergenic
1154496885 18:14967756-14967778 CTGAACTGTAGCAGGTCAGGTGG + Intergenic
1156063356 18:33109071-33109093 CTGCATTGAATGTGGAAAGGGGG - Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1165862215 19:38915299-38915321 CAGCACTGTAGGAGGAAAGAAGG + Intronic
1168214843 19:54917850-54917872 CTGCACTGAAGGGTGTAAGGTGG - Intergenic
925945334 2:8857262-8857284 CTGCCCTGTAGGAGGGGAGGGGG - Exonic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926974452 2:18499807-18499829 CTGCACTGAATAAAGTCAGGGGG - Intergenic
926989891 2:18667475-18667497 TTGCACTAAAAGAGGTAAGGAGG - Intergenic
928315970 2:30246204-30246226 CAGCACTTTAGGAGGTAAGGCGG - Intronic
928519373 2:32073575-32073597 CCGCACTTTATGGGGTGAGGTGG - Intronic
929163151 2:38853584-38853606 CTGGACTGTAAGAGATGAGGGGG + Intronic
929592300 2:43155222-43155244 CTGCATTGTATGGGGTAACCTGG + Intergenic
930818003 2:55618503-55618525 TTGCACTGAATAAGGAAAGGAGG + Intronic
936802015 2:116281683-116281705 CTTCACAGAATGAGTTAAGGAGG - Intergenic
941657326 2:168158147-168158169 CTGCACTGTGTGATAGAAGGGGG - Intronic
942340516 2:174940377-174940399 ATGGACTGTATTAGGTAATGTGG - Intronic
945992152 2:216405178-216405200 CAGCACTTTAGGAGGTGAGGCGG - Intergenic
946232041 2:218297433-218297455 CAGCACTGTGGGAGGTCAGGGGG + Intronic
947754612 2:232552456-232552478 CAGCACTTTAGGAGGCAAGGTGG - Intronic
1169304597 20:4477582-4477604 CTGCATTGCATCAGGGAAGGTGG - Intergenic
1169864128 20:10181794-10181816 ATGGACTGTGTGAGGTAAGATGG + Intergenic
1170982299 20:21226230-21226252 CTGCCCTGTAGCAGGCAAGGAGG - Intronic
1172987066 20:39000160-39000182 CTGCACTGTAAAGGCTAAGGAGG - Intronic
1181335443 22:22124983-22125005 CTGCACTGCCCGAGGTAGGGGGG + Intergenic
1182897556 22:33871375-33871397 CAGCACTGTGTCAGGTAAGGGGG + Intronic
1183084080 22:35475696-35475718 CTGCAAAGCATGAGGGAAGGGGG + Intergenic
1183201818 22:36390340-36390362 CAGCACTTTGGGAGGTAAGGTGG + Intergenic
1184049736 22:41995510-41995532 AAGCAATGTATGAGGGAAGGAGG - Intronic
950177833 3:10888138-10888160 CTCCACTGTGTGACGTTAGGCGG + Intronic
953683725 3:45060014-45060036 CTGCCCGGTGTGAGGGAAGGGGG - Intergenic
958497090 3:94859169-94859191 CTTCACAGAATGAGTTAAGGAGG + Intergenic
958967499 3:100575617-100575639 CAGCACTGTGGGAGGCAAGGCGG - Intronic
959427362 3:106207532-106207554 CTGCACTTTGGGAGGTGAGGTGG + Intergenic
963785931 3:149534444-149534466 CTGAACTGTCTGAGGTAGAGGGG - Intronic
963881874 3:150537604-150537626 CTTCACTGTATGAGGCAGGTGGG + Intergenic
963943739 3:151122150-151122172 CTGCTCTGAATGAGGCAAAGTGG - Intronic
967796306 3:193602279-193602301 CTGCACTGTGGGTGGTAAGAAGG + Intronic
967997340 3:195176815-195176837 CTGTGCTCTGTGAGGTAAGGAGG - Intronic
968525087 4:1052650-1052672 ATGCACTGCATGAGGACAGGCGG + Intergenic
969227889 4:5811091-5811113 CAGCACTGCAGGAGGGAAGGTGG - Exonic
969599820 4:8169690-8169712 CTGCATTGTGTGAGGAATGGGGG - Intergenic
969957691 4:10908612-10908634 CAGCACAGTAGGAGCTAAGGTGG - Intergenic
971688179 4:29797894-29797916 CACCTCTGTATCAGGTAAGGTGG - Intergenic
975760319 4:77613663-77613685 CTGGAGTGTCTGAGGAAAGGCGG + Intergenic
977996336 4:103500914-103500936 CTGCACTGTTTGGGGTATGGAGG - Intergenic
979055583 4:115989011-115989033 CAGCACTTTGTGAGGCAAGGCGG - Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
981336095 4:143570363-143570385 CTGCACTGTTTGAGGGTGGGGGG + Intergenic
981538618 4:145825363-145825385 CTGCAGTGTCTTAAGTAAGGGGG + Intronic
981874178 4:149520839-149520861 CTGCAAAGTAGGAGGCAAGGTGG - Intergenic
983059463 4:163141115-163141137 CAGCACTTTAGGAGGTGAGGCGG + Intronic
983211397 4:164962082-164962104 CTGTACTGTATGTGGTCAGTGGG + Intronic
987033260 5:13995226-13995248 GTGCACTGTATGTGGCAATGTGG - Intergenic
988994797 5:36704449-36704471 ATGCACAGTAAGAGGTGAGGAGG + Intergenic
991277898 5:64872358-64872380 CTGCACTGTATGAGAGAGGCAGG + Intronic
994603332 5:101936363-101936385 CAGCACTTTAGGAGGCAAGGTGG - Intergenic
994923356 5:106081470-106081492 ATGCATTGTATGAGGTGAAGGGG - Intergenic
995245334 5:109928914-109928936 ATGCAGTGTGTGAGGTAAAGAGG + Intergenic
996256088 5:121404332-121404354 CAGCACTTTATGAGGTCAAGGGG - Intergenic
998384459 5:141748463-141748485 CTGCAATGTTTGAGGTATGCAGG - Intergenic
999470665 5:151852056-151852078 CTGCCTTGTATGAGGAAAGAAGG - Intronic
1001314977 5:170635638-170635660 CTGCACTGTAAGGGACAAGGGGG + Intronic
1004098501 6:12583871-12583893 CAGCACTTTAGGAGGCAAGGCGG + Intergenic
1007449885 6:41934887-41934909 CTGCACTGTATGAGGTAAGGAGG - Intergenic
1008315435 6:50033813-50033835 CTTCACAGAATGAGGTAGGGAGG - Intergenic
1009417922 6:63436347-63436369 CAGCACTTTAAGAGGTGAGGTGG - Intergenic
1011003735 6:82620806-82620828 ATGCACTGCATGAGTTAAGGAGG + Intergenic
1011978032 6:93331926-93331948 CTGAACTGTGTGAGGCAATGTGG - Intronic
1012929149 6:105298608-105298630 CTGCCCTGTATCATGAAAGGGGG + Intronic
1013216272 6:108030230-108030252 CTACACTGTATGATGTTAGAAGG - Intergenic
1014350337 6:120334710-120334732 CTGCAAAGTCTGAGGTGAGGTGG + Intergenic
1015672161 6:135703033-135703055 TTGCACTGCTTGAGGTTAGGAGG + Intergenic
1016284548 6:142458270-142458292 GTGAACTGTATGAGGGGAGGAGG + Intergenic
1016511586 6:144848982-144849004 ATGCAGTGTATGAGGAATGGGGG + Intronic
1016795638 6:148114326-148114348 CAGCACTATAGGAGGTGAGGTGG + Intergenic
1018056421 6:160056013-160056035 CTGCGCTGTCAGAGGTCAGGAGG - Intronic
1020458219 7:8398427-8398449 CTGCCTTGGATGAGGTATGGGGG - Intergenic
1024466161 7:49713438-49713460 ATGCACAGTCAGAGGTAAGGAGG + Intergenic
1027250646 7:76396745-76396767 CTGCTCTGTAAGAGATAAAGTGG - Intronic
1035395187 7:158530356-158530378 TTGGACTGAATGAGGGAAGGTGG + Intronic
1037483428 8:19326071-19326093 TTGGACTGTATGAGGTAAGCTGG + Intronic
1041465161 8:58151054-58151076 CTGAACTGTATGAGGAATTGTGG - Intronic
1042901963 8:73737648-73737670 CAGCACTTTCTGAGGTGAGGTGG - Intronic
1044892536 8:96852586-96852608 CTAAACTGAAGGAGGTAAGGAGG - Intronic
1045641767 8:104259477-104259499 CTGCACAGTGGGAGGTGAGGAGG - Intergenic
1052997312 9:34558034-34558056 CTGCACTGTATGGGGACAGGTGG + Intronic
1055802081 9:80049309-80049331 TTCCACTGTCAGAGGTAAGGTGG + Intergenic
1058317661 9:103588207-103588229 CTGCACTGTAAGTGCTCAGGTGG + Intergenic
1059684281 9:116619776-116619798 CTGCACTTTAGGAGGTGAGGTGG - Intronic
1062337596 9:136079226-136079248 CTGCACTCTCTGAGCTGAGGGGG + Intronic
1185803183 X:3031953-3031975 CTGCACTCCATGCAGTAAGGAGG + Intronic
1188399309 X:29725336-29725358 CTCCATTATATGAGGTAAAGGGG + Intronic
1190028279 X:46946587-46946609 CTGATCTGTATGAGCTAAGATGG + Intronic
1190341719 X:49302128-49302150 CAGCACTGTGGGAGGTGAGGCGG - Intergenic
1190347352 X:49530649-49530671 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1190348451 X:49540205-49540227 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1190349552 X:49549761-49549783 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1190350656 X:49559314-49559336 CAGCACTGTGGGAGGTGAGGTGG - Intronic
1190351758 X:49568872-49568894 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1190352858 X:49578421-49578443 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1190353959 X:49587968-49587990 CAGCACTGTGGGAGGTGAGGTGG - Intergenic
1190355061 X:49597492-49597514 CAGCACTGTGGGAGGTGAGGTGG - Intronic
1192174146 X:68875395-68875417 CTGCAGTGCATCAGGCAAGGAGG + Intergenic
1192888127 X:75359027-75359049 TGGCACTGTATGAGGTACAGAGG + Intergenic
1196270124 X:113700095-113700117 CTGCACTGTCTGTGGTTGGGGGG + Intergenic
1197124652 X:122930151-122930173 CTCCACTGTATTAGGAAATGAGG + Intergenic
1198374505 X:136025092-136025114 CTGCAATGTATGAGACAATGCGG + Intronic
1199170572 X:144730603-144730625 CTTCACTGAATGAGTTAGGGAGG - Intergenic
1202088077 Y:21160141-21160163 CTGGACTGTATGAGAAAAGCAGG + Intergenic