ID: 1007450025

View in Genome Browser
Species Human (GRCh38)
Location 6:41935676-41935698
Sequence GGCCCACCCCCAGCTAGAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007450020_1007450025 -2 Left 1007450020 6:41935655-41935677 CCAATTCTGTCCCATCAGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 273
Right 1007450025 6:41935676-41935698 GGCCCACCCCCAGCTAGAGTTGG 0: 1
1: 0
2: 1
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007450025 Original CRISPR GGCCCACCCCCAGCTAGAGT TGG Exonic
901700886 1:11044347-11044369 ACCCCACCCCCAGCTGCAGTGGG + Intronic
902823532 1:18957218-18957240 GGGCCTCCCCAGGCTAGAGTGGG - Intergenic
903213574 1:21831427-21831449 GGCCCAGCCTCAGCTGGAGGTGG + Intronic
906670687 1:47652228-47652250 GGCTCATCCCCTGCCAGAGTAGG - Intergenic
907147474 1:52248426-52248448 TGCCCACCCCCATTGAGAGTGGG + Intronic
921219052 1:212960430-212960452 GTCCCACCCCCAGATGGATTAGG - Intronic
1064141560 10:12795086-12795108 GGCCCATGCACAGCTATAGTAGG + Intronic
1065835642 10:29655515-29655537 TGCCCACCCACAGCAAGGGTGGG + Intronic
1070273005 10:74976142-74976164 AGCCATCCCCCAGCTAGAGGAGG - Exonic
1070771551 10:79085320-79085342 CCCCCACCCCCAGCTTGAGGAGG - Intronic
1071499852 10:86195606-86195628 TGCCAACCCCCAGCCAGGGTAGG - Intronic
1074833486 10:117266463-117266485 AGCCCACCACCAGCCAGAGATGG + Intronic
1076981526 11:207408-207430 GCCCCGCCCCCAGCTAGCGATGG + Exonic
1077181828 11:1220358-1220380 CCCTCACCCCCAGCTCGAGTGGG - Intergenic
1078147211 11:8730223-8730245 GGCCCACCCCCAGAGAGGGAAGG - Exonic
1083263425 11:61535389-61535411 GGCCCACCCCCACCCCAAGTGGG - Intronic
1083295563 11:61713690-61713712 GGCTCCACCCCAGCTAGGGTGGG - Intronic
1083799748 11:65039783-65039805 GGCCCACTCCCTGTTAGGGTGGG - Exonic
1088893924 11:114063979-114064001 CGCCCACCCCCAGCCAGAGTTGG - Exonic
1089125290 11:116172402-116172424 GGCCCAGCCCTAGCTAGAGCTGG + Intergenic
1089192074 11:116660543-116660565 GTCCCACCACCACCTACAGTGGG + Intergenic
1094058071 12:26286385-26286407 GGCCCACCTCCAGCACCAGTGGG + Intronic
1099809902 12:87567712-87567734 GCCCCACCCCAAGCCAGAGATGG - Intergenic
1101422552 12:104561599-104561621 GGCTCACCCACAGCTTGAATTGG + Intronic
1101552401 12:105774926-105774948 GCTCCAACTCCAGCTAGAGTAGG - Intergenic
1102462209 12:113106888-113106910 GGCCCATCCCCAGCCAGTGTGGG - Intronic
1102626885 12:114242261-114242283 AGTCCACCCCCAGCTACAATGGG + Intergenic
1107276658 13:38687205-38687227 GGCCCAGCCCCGGCTACAGGAGG + Exonic
1108709507 13:53018523-53018545 GGGTCACCCCCAGCTACAGTTGG + Intergenic
1108882806 13:55142053-55142075 GGCCCACTCCCAGTGAGGGTGGG - Intergenic
1122770137 14:104094141-104094163 CGCCCACCCCCAGCTTGCATGGG - Intronic
1124433832 15:29631708-29631730 TCCCCACCCCCAGCTAGACATGG - Intergenic
1125601769 15:40919300-40919322 GCTCCACCCCCAGCTTGAGCTGG + Intergenic
1132180986 15:99752747-99752769 GGCTCAGCCCCAGGCAGAGTTGG - Intergenic
1133621712 16:7532555-7532577 GCCCCATCCACAGCTAGACTAGG - Intronic
1134104448 16:11475972-11475994 GGGCCTCCCCTAGCTGGAGTAGG + Intronic
1134119194 16:11571692-11571714 GGCCCACTCCCACCTAGAGATGG - Intronic
1138493867 16:57394993-57395015 TGCCCACCCCCAGCCAGCGGCGG - Intergenic
1139339589 16:66259403-66259425 TGCCCCGCCCCAGCTAGAGCAGG + Intergenic
1141849632 16:86636532-86636554 GCCCCACCCCCAGCTAAAGGAGG - Intergenic
1142093271 16:88226428-88226450 GGGCCTCCCACAGCTGGAGTGGG + Intergenic
1142151450 16:88514314-88514336 AGCCCACCTCCCGCTAGGGTTGG - Intronic
1142373900 16:89697175-89697197 GTCCCACCTCCAGCAAGGGTTGG + Exonic
1142494675 17:299980-300002 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494688 17:300027-300049 GGGCCAGCCCCTTCTAGAGTGGG - Intronic
1142494699 17:300074-300096 GGGCCAGCCCCTGCTAGAGTGGG - Intronic
1142494711 17:300121-300143 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494722 17:300168-300190 GGGCCAGCCCCTTCTAGAGTGGG - Intronic
1142494733 17:300215-300237 GGGCCAGCCCCTTCTAGAGTGGG - Intronic
1142494744 17:300262-300284 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494765 17:300353-300375 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494775 17:300400-300422 GGGCCAGCCCCTTCTAGAGTGGG - Intronic
1142494785 17:300447-300469 GGGCCAGCCCCTTCTAGAGTGGG - Intronic
1142494796 17:300494-300516 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494817 17:300585-300607 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494827 17:300632-300654 GGGCCAGCCCCTTCTAGAGTGGG - Intronic
1142494837 17:300679-300701 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494847 17:300726-300748 GGGCCAGCCCCTGCTAGAGTGGG - Intronic
1142494857 17:300770-300792 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494869 17:300817-300839 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494880 17:300864-300886 GGGCCAGCCCCTGCTAGAGCGGG - Intronic
1142494899 17:300958-300980 AGGCCAGCCCCTGCTAGAGTGGG - Intronic
1142501739 17:336875-336897 GGGCCACCCCCAGGTGGAGGAGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1152368638 17:79871530-79871552 GTCCCACCACCAGCTGGAGTGGG + Intergenic
1152587131 17:81194149-81194171 GGGCCACGTCCAGCTAGGGTGGG + Intronic
1153085741 18:1284826-1284848 GGCCCACCTCCAGCCTCAGTGGG - Intergenic
1155000999 18:21686780-21686802 TGCTCATCCCCAGCTGGAGTGGG - Intronic
1160178584 18:76615507-76615529 GGCCCAGCCCCAGGTGGAGGAGG - Intergenic
1163411640 19:17158629-17158651 TGCCCACCAGCAGCAAGAGTGGG - Intronic
1165067943 19:33240034-33240056 GCCCCTCCCCCATCTAAAGTGGG + Intergenic
1165914092 19:39247454-39247476 GTCCCACCTCCAGCTTGAGCTGG - Intergenic
1166194679 19:41197983-41198005 GGGCCACCCCCAGCCACAGTAGG - Intronic
925739824 2:6995733-6995755 GACCCACCCTCAGCCAGGGTAGG - Intronic
927276554 2:21267099-21267121 GGCTCAGCCCCACCTAGACTTGG + Intergenic
928180428 2:29064877-29064899 GGCGCAGCCCCAGCAAGAGGAGG - Exonic
929544377 2:42846163-42846185 GGCCCTTCCCCAGCTTAAGTGGG - Intergenic
929554420 2:42916514-42916536 GGTCCTCCCCCAGCTAGATTGGG + Intergenic
934736884 2:96694125-96694147 GTCCCACCCCCAGCCAGCGGGGG + Intergenic
937631724 2:124109358-124109380 GGCACACACACAGGTAGAGTTGG + Intronic
948537406 2:238656445-238656467 GCCCCACCCCCAACTAGACCAGG + Intergenic
1172436993 20:34936323-34936345 GGGCCACCACCAGGTAGATTTGG - Intronic
1173555600 20:43963305-43963327 TCCCCACCCCCAACAAGAGTTGG - Intronic
1173992712 20:47315536-47315558 GGCCCAGCCCCCACTGGAGTGGG - Intronic
1174386336 20:50190440-50190462 GGCCCGCCCCCTGCTGGAGGAGG - Intergenic
1175500143 20:59444293-59444315 CGCCCACCCCCAACTAGGTTGGG - Intergenic
1181163601 22:20971902-20971924 GGCTCACTCCCCGCTAGAGCTGG + Intronic
1181631704 22:24155108-24155130 GGCCTCCCCTCAGCTGGAGTGGG + Intronic
1183406525 22:37633049-37633071 GCCCCAACCCCAGCTGGGGTGGG + Exonic
1184235775 22:43182323-43182345 TGCCCACTCCCAGCTGGAGGAGG + Intronic
1184243044 22:43221375-43221397 GCCCCACCCCCAGCTCCAGATGG - Intronic
1184635308 22:45823856-45823878 GGCACACCCCCTGCTAGGCTTGG + Intronic
951047966 3:18062516-18062538 GGGCCACCCCCAGCATGTGTGGG - Intronic
952195899 3:31075123-31075145 TGCTCACCCCCAGCTACTGTGGG - Intergenic
955076746 3:55621154-55621176 GCCCCCCCTCCAGCCAGAGTTGG + Intronic
961002257 3:123381959-123381981 TGCCCACCACCAGCTGGACTTGG - Intronic
967889670 3:194356316-194356338 GTCCCACGCCCATCTGGAGTGGG - Intronic
967956496 3:194881378-194881400 GGCCCACCTCCAGGGAGAGCAGG + Intergenic
968628026 4:1636873-1636895 GACCCCCCCCCAGCAAGAGCAGG - Intronic
968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG + Intergenic
969425260 4:7120588-7120610 GGCCCACCCCCAGTGAAAGGGGG - Intergenic
978392212 4:108238923-108238945 GTCCCATGCCCAGCTAGAGATGG - Intergenic
992483836 5:77176921-77176943 GCCCCACCTCCAGCTAGACTTGG + Intergenic
995052139 5:107719166-107719188 GGCTCACCCCTAGCCAGAGGAGG + Intergenic
999133086 5:149299422-149299444 GGCCCCCCACCACCTAGAGTTGG - Intronic
999854457 5:155579086-155579108 TACCCACCCTCACCTAGAGTGGG + Intergenic
1002185430 5:177452604-177452626 GCTCCACCCCCAGGTGGAGTGGG - Intronic
1007450025 6:41935676-41935698 GGCCCACCCCCAGCTAGAGTTGG + Exonic
1007482296 6:42158213-42158235 GCCCCACCCTCAGCCAGAGCTGG + Intronic
1007527885 6:42512673-42512695 ACCCCACCCCCAACCAGAGTAGG + Intergenic
1014090120 6:117395073-117395095 GGTCCACCCCAGGCCAGAGTGGG + Intronic
1019632483 7:2057122-2057144 GCCCCAGCCCCACCTAGAGAGGG + Intronic
1033399890 7:141012404-141012426 ACCCCACCCCCAACCAGAGTTGG - Intronic
1035231505 7:157468640-157468662 AGCCCACCCCCAGACAGCGTGGG - Intergenic
1036201894 8:6777007-6777029 GCCCCACCCGCATCCAGAGTGGG - Intergenic
1036631613 8:10519796-10519818 GGTCAACCCCTAGCTTGAGTGGG - Intergenic
1036760486 8:11505565-11505587 GGCCCTCCCCCTTCTAGACTGGG + Intronic
1037077208 8:14735322-14735344 TGCCCACCCACATCGAGAGTGGG - Intronic
1037410306 8:18588909-18588931 GGCCCACCCTGAGATGGAGTGGG + Intronic
1041594565 8:59633312-59633334 GGCAGTCCCCCAGCTAGAGAAGG - Intergenic
1049547230 8:143238683-143238705 GCCCCTACCCCAGCTACAGTGGG + Intergenic
1056808301 9:89745235-89745257 GGCCCTCCCCCACTGAGAGTGGG - Intergenic
1058439119 9:104991363-104991385 GGCCCCTCCCCAGCAAGAATGGG + Intergenic
1061203928 9:129152357-129152379 GACCCAACCCCTGGTAGAGTGGG + Intergenic
1061764285 9:132871615-132871637 GGCTGGCCCCCAGCTAGAGACGG + Intronic
1062018582 9:134304900-134304922 TCCCCACCCCCAGCTAGAAAAGG + Intergenic
1190458354 X:50646438-50646460 GGCCCACCCCCACCCACTGTTGG + Intronic
1190905469 X:54722913-54722935 GGCCCACCCACAACTAGATCTGG - Intergenic
1192203284 X:69080797-69080819 CCCCCACCCCCAGCTACAGATGG - Intergenic
1198773663 X:140156601-140156623 ACCCCACCCCCAGCTCCAGTTGG + Intergenic
1200044172 X:153392302-153392324 TTCCCAGCCCCAGTTAGAGTTGG - Intergenic
1200093705 X:153647590-153647612 CGCACACCCCCAGCCAGAGTCGG + Intronic