ID: 1007451261

View in Genome Browser
Species Human (GRCh38)
Location 6:41941580-41941602
Sequence GCCGGACCCGCGGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007451261_1007451279 30 Left 1007451261 6:41941580-41941602 CCCCCAGCAGCCGCGGGTCCGGC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1007451279 6:41941633-41941655 CAACACAGCAGCTCCATACTCGG 0: 1
1: 0
2: 0
3: 16
4: 195
1007451261_1007451271 -2 Left 1007451261 6:41941580-41941602 CCCCCAGCAGCCGCGGGTCCGGC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1007451271 6:41941601-41941623 GCCCGGCCCGGGGCGCGTGCCGG 0: 1
1: 0
2: 1
3: 45
4: 364
1007451261_1007451273 -1 Left 1007451261 6:41941580-41941602 CCCCCAGCAGCCGCGGGTCCGGC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1007451273 6:41941602-41941624 CCCGGCCCGGGGCGCGTGCCGGG 0: 1
1: 0
2: 3
3: 39
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007451261 Original CRISPR GCCGGACCCGCGGCTGCTGG GGG (reversed) Exonic