ID: 1007452438

View in Genome Browser
Species Human (GRCh38)
Location 6:41950478-41950500
Sequence TCTCATTTGCAAAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007452431_1007452438 12 Left 1007452431 6:41950443-41950465 CCTGGGCAGTTTACTTAACTTTT 0: 1
1: 1
2: 15
3: 100
4: 628
Right 1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007452438 Original CRISPR TCTCATTTGCAAAAGGAGGA TGG Intronic
No off target data available for this crispr