ID: 1007453860

View in Genome Browser
Species Human (GRCh38)
Location 6:41961147-41961169
Sequence CATTGCTGGGATTGTTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007453860_1007453865 11 Left 1007453860 6:41961147-41961169 CCTGTCAAACAATCCCAGCAATG 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1007453865 6:41961181-41961203 ACAATCCTTGTGGCCGAGCGTGG No data
1007453860_1007453864 1 Left 1007453860 6:41961147-41961169 CCTGTCAAACAATCCCAGCAATG 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1007453864 6:41961171-41961193 CTTCATCAAAACAATCCTTGTGG No data
1007453860_1007453866 14 Left 1007453860 6:41961147-41961169 CCTGTCAAACAATCCCAGCAATG 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1007453866 6:41961184-41961206 ATCCTTGTGGCCGAGCGTGGTGG 0: 1
1: 0
2: 9
3: 122
4: 1109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007453860 Original CRISPR CATTGCTGGGATTGTTTGAC AGG (reversed) Intronic
901610781 1:10496251-10496273 CACTGCTGGGACTGTTTCAGGGG + Intronic
902321179 1:15667599-15667621 GATGGCTGGGATTGGTGGACAGG + Exonic
902694055 1:18128485-18128507 CATTGCTGGGAATCTGTCACTGG + Intronic
902756728 1:18553738-18553760 CATTGCTTGGATTGGTTTAAAGG - Intergenic
903250422 1:22049284-22049306 CATTCATGGGATTGTGAGACAGG + Intergenic
903256248 1:22103165-22103187 TACTACTGGGATTGCTTGACAGG - Intergenic
904474678 1:30757250-30757272 GTGGGCTGGGATTGTTTGACCGG - Intronic
905621397 1:39451102-39451124 CTTTGCAGGCATTGGTTGACTGG + Exonic
906567588 1:46812021-46812043 CATTGCTGGGTGTGTTGGAGTGG + Intronic
909681903 1:78301058-78301080 CATTACTGGGAGTTTTTGATTGG + Intergenic
911216675 1:95202508-95202530 CACTGCTGGGATTATTTGATGGG + Intronic
912546941 1:110457646-110457668 CATTGCTGAGATTGCTTAGCAGG + Intergenic
918313760 1:183305637-183305659 CAGTGCGGGGATTTTTTGAAAGG + Intronic
919049189 1:192492367-192492389 CATTGCTGAAATTGTATCACAGG + Intergenic
1063000666 10:1917475-1917497 GATTGTTGGGATTGTTTACCTGG - Intergenic
1064751963 10:18539311-18539333 CGGTGCTGGGATTTCTTGACTGG - Exonic
1066059307 10:31707964-31707986 CATGGCTGGGATTTTCTCACAGG + Intergenic
1069505554 10:68994767-68994789 GATTGCAGTGATTGTTTCACAGG - Intronic
1069986459 10:72287474-72287496 TATTGCTGGGCTTGTTTCAAGGG + Intergenic
1070850174 10:79556984-79557006 CAGTGCTGGGATGGTTTGCAAGG + Exonic
1075907060 10:126090678-126090700 CATTGCAGGGATGGTTGGAGGGG - Intronic
1077209702 11:1363621-1363643 CATTGCTGGGATGGATGAACAGG + Intergenic
1078205615 11:9226851-9226873 CATAGCTTGGATTTATTGACAGG - Intronic
1078561243 11:12374890-12374912 CATTGGTGGGAATGGTTGCCAGG - Intergenic
1083031540 11:59597306-59597328 AAGTGCTGGGATTTTTTTACAGG + Intronic
1085608120 11:77921412-77921434 CAATGCTGGCATTGTTGGACAGG + Exonic
1088708262 11:112483032-112483054 CATGGCTGGGTTAGCTTGACTGG + Intergenic
1090096043 11:123742433-123742455 CATTGCTGGGATCTGTTTACTGG + Intergenic
1091769857 12:3144480-3144502 CATTGCTGGGAATCCTTGGCAGG - Intronic
1097725110 12:63066358-63066380 GATGGCTGCGATTGATTGACTGG - Intergenic
1098071821 12:66684065-66684087 CATTTCTAGGCTTGTTTGAATGG + Intronic
1102034978 12:109765932-109765954 GATGGCTGGGAGGGTTTGACGGG - Intronic
1110675492 13:78238517-78238539 CATTGCTGGAGCTGATTGACAGG - Intergenic
1111082451 13:83329085-83329107 CATTGCTGGGATTTTTTCCAAGG + Intergenic
1114658594 14:24330850-24330872 CATGACTGGGAATGTTTGAGAGG + Intronic
1114696092 14:24629144-24629166 GGTTGCTGGGAGTGTTTGGCAGG + Intergenic
1117721615 14:58634264-58634286 CAATGCTGGTCTTGTTTGAAAGG - Intronic
1121225292 14:92317372-92317394 CAGTGCTGGGTTTCTTTGACAGG + Intergenic
1125855368 15:42943677-42943699 TATTGAGTGGATTGTTTGACTGG - Exonic
1128417817 15:67463108-67463130 CACTGCTAGATTTGTTTGACAGG + Intronic
1129245785 15:74277942-74277964 CATGGCTGGGACTGTCTGCCAGG - Intronic
1137354512 16:47747724-47747746 CATTACTGGGTCTGTTTGATTGG + Intergenic
1139076379 16:63454258-63454280 CATTGTTGCTATTGTTTGACAGG + Intergenic
1146632660 17:34482080-34482102 TATTGCTGGGAGTGTTCTACTGG - Intergenic
1147463094 17:40588524-40588546 CATTACTGGGGTTGGTTGTCTGG + Intergenic
1147789783 17:43006598-43006620 GATTGCTGGGAATGGTTGATGGG + Intergenic
1150115491 17:62545286-62545308 AAGTGCTGGGATTGTTTTAAAGG + Intronic
1158354634 18:56604060-56604082 CATTTCTAGGATTGTGTGATTGG - Intronic
928894194 2:36241945-36241967 CAGGGCTGGGATTGTAAGACTGG + Intergenic
929422005 2:41800902-41800924 CAATGCTCAGATTGTTTCACTGG - Intergenic
930999632 2:57764820-57764842 CACTGCTGGGCTTGTTTTAGAGG - Intergenic
932449512 2:71800604-71800626 CATGGCTGGGATTTTGTGAATGG - Intergenic
945929963 2:215844853-215844875 CATGGCTGGGATGCTCTGACTGG - Intergenic
947491156 2:230595244-230595266 CAATTCTTGGATTGTTTTACTGG - Intergenic
948393211 2:237627265-237627287 CTTTGCGGGGACTGTTTGGCGGG - Intergenic
1169442109 20:5641193-5641215 CATCGCTGGGATTAAATGACTGG - Intergenic
1170825775 20:19793851-19793873 CATTGCTGGGGTTGCTAGATAGG + Intergenic
1172427258 20:34863642-34863664 CAGTGCGGGGATTGTGTGGCAGG - Intronic
1172437697 20:34941762-34941784 CCTTGCTGGGATTATTAGAGAGG + Exonic
1173294651 20:41746357-41746379 CATTTCCAGGATTGTTTTACAGG + Intergenic
1174287932 20:49485066-49485088 CATTTCTGGGATTATGTGATGGG - Intergenic
1174733113 20:52937612-52937634 AATTGCTGGCATTCTTTAACGGG + Intergenic
1174888883 20:54367971-54367993 AATTGCTGGTATTGTTTTAGTGG - Intergenic
1175164890 20:57036424-57036446 CATTGCTGGGATTTTTGCAGGGG - Intergenic
1175688856 20:61051187-61051209 CATAGCTGGGCTTGATTGACTGG - Intergenic
1177879547 21:26675478-26675500 CAGTGATGGGTTTTTTTGACAGG - Intergenic
1179133341 21:38658883-38658905 CATTGAAGGGATTGTGTGAGGGG - Intronic
1179245444 21:39630160-39630182 CATTGATGGGTTTGTTGGAGAGG - Intronic
952333912 3:32388819-32388841 CATTGCTGGGCTTTTCTGCCTGG - Intergenic
952703324 3:36349279-36349301 TATTACTGGGATTGTTTTTCTGG - Intergenic
956849895 3:73219299-73219321 GATTGGTGGGATTGTATGAGTGG + Intergenic
957269908 3:78016464-78016486 CATTGCAGGGCATGTTTGAGCGG - Intergenic
957543224 3:81603181-81603203 AATTCCTAGGATTGCTTGACAGG - Intronic
960609268 3:119540321-119540343 CATTCCTGGAAGTGTTTGCCTGG - Intronic
961797732 3:129421774-129421796 CATTGATGGGAGTCTTAGACGGG + Exonic
963699533 3:148607210-148607232 CCATGCTGGGATTGCTTGCCAGG - Intergenic
963763822 3:149312482-149312504 CATTTCAGGGCTTATTTGACTGG - Intergenic
969560586 4:7944797-7944819 GATTGCTGGTGTTGTTTCACTGG - Intergenic
978508499 4:109487747-109487769 CATTGCTTTGATATTTTGACAGG + Intronic
982459761 4:155654603-155654625 CATTGTTGGTATTGTTTGACAGG + Intergenic
982600396 4:157442610-157442632 CATTTCTGGGATGATTTCACGGG + Intergenic
987438369 5:17925693-17925715 CCTTGCTGTGATTGTGTGGCAGG - Intergenic
987867073 5:23557044-23557066 CATTGCTGTGAATTTTTGAAAGG + Intergenic
989995553 5:50825064-50825086 CATTGCAGGGCTTGTAAGACAGG - Intronic
992577638 5:78134408-78134430 CATTGCTGTTATTTTTTAACAGG + Intronic
999038151 5:148376480-148376502 GATTGCGGGGAATGTTTGACTGG - Intergenic
1002451386 5:179320809-179320831 TATTGCTGGAATTGTTGGAAAGG + Intronic
1003274453 6:4637327-4637349 CTGTGTTGGGATAGTTTGACAGG - Intergenic
1004947847 6:20635396-20635418 AATAGCTGGGATCATTTGACAGG - Intronic
1007453860 6:41961147-41961169 CATTGCTGGGATTGTTTGACAGG - Intronic
1011237643 6:85235253-85235275 CATTGCTTGCATTTTTTGGCTGG - Intergenic
1012034463 6:94114764-94114786 CATTGCAGTGATTGTTTCATAGG - Intergenic
1012698296 6:102418150-102418172 CATTGCTTGAATTATTTAACTGG - Intergenic
1017215327 6:151900529-151900551 TATTACTGGGATTGTTTTTCTGG + Intronic
1020523648 7:9228726-9228748 CATTCCTGGTAATGTTTGATTGG - Intergenic
1025844783 7:65186429-65186451 CAATGCTCGCATTGTTGGACAGG - Intergenic
1025895111 7:65692762-65692784 CAATGCTCGCATTGTTGGACAGG - Intergenic
1027367343 7:77471886-77471908 GTATGCTGGGAATGTTTGACAGG - Intergenic
1029328377 7:99829835-99829857 CATTGCTAGGAATGTGAGACTGG + Intronic
1032045218 7:128600978-128601000 AAGTGCTGGGATTGTTTTAAAGG + Intergenic
1037016938 8:13919628-13919650 CATTGCTGGTATTGATTGATAGG + Intergenic
1039088072 8:33799598-33799620 CATTGCTCTGATTTTTTGCCTGG + Intergenic
1039404486 8:37300959-37300981 CTTAGCTGGGATTGTTGGCCGGG - Intergenic
1039492626 8:37959336-37959358 AATCCTTGGGATTGTTTGACTGG - Intergenic
1040735337 8:50500798-50500820 CCCTGCTGGGATTGTTTGAAGGG + Intronic
1042069681 8:64917468-64917490 CATTGCTGGAGTGGGTTGACAGG + Intergenic
1042145544 8:65725249-65725271 CCTTGCTGGGATTCTTTTGCTGG + Intronic
1046290172 8:112148924-112148946 CATAGCTGAGATTCTTTCACAGG - Intergenic
1047414318 8:124651670-124651692 CATGGCTGGTACTGTCTGACTGG - Intronic
1047720936 8:127638444-127638466 CATTGCTGTGTTTGTTTGTCTGG - Intergenic
1049623854 8:143611438-143611460 CCCTGCTGGGATTGTTTGTCTGG - Intergenic
1053463180 9:38286470-38286492 CATTGCTGGGATCTTCTGAGAGG + Intergenic
1057964951 9:99493640-99493662 CATTGCTGCCAGAGTTTGACAGG - Intergenic
1185787717 X:2904777-2904799 GATTGTTGGGATTGTTTGAATGG + Exonic
1190183464 X:48214377-48214399 CAATGCTGGGATTGTTACACAGG - Intronic
1190389295 X:49916111-49916133 AATTGGTGGGACTCTTTGACTGG + Intergenic
1191078963 X:56488168-56488190 CATTGGTGGACTTGTTTGCCTGG + Intergenic
1192573077 X:72222105-72222127 AATGGCTGGGGTGGTTTGACTGG - Intronic
1193196468 X:78638518-78638540 CATCTCTTGGATTGTTTTACTGG + Intergenic
1194555137 X:95349093-95349115 CATTGAAGGTATTTTTTGACCGG - Intergenic
1194614961 X:96088721-96088743 CATTGCTAGAATTGTTTTTCTGG - Intergenic
1197914060 X:131515497-131515519 CATTGCTTTGATGGTTTTACAGG - Intergenic