ID: 1007453864

View in Genome Browser
Species Human (GRCh38)
Location 6:41961171-41961193
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007453859_1007453864 2 Left 1007453859 6:41961146-41961168 CCCTGTCAAACAATCCCAGCAAT No data
Right 1007453864 6:41961171-41961193 CTTCATCAAAACAATCCTTGTGG No data
1007453860_1007453864 1 Left 1007453860 6:41961147-41961169 CCTGTCAAACAATCCCAGCAATG 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1007453864 6:41961171-41961193 CTTCATCAAAACAATCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type