ID: 1007454623

View in Genome Browser
Species Human (GRCh38)
Location 6:41966868-41966890
Sequence GAGAATTCACACAAATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007454618_1007454623 5 Left 1007454618 6:41966840-41966862 CCTTAAGCCCTCTACAGCATGAA No data
Right 1007454623 6:41966868-41966890 GAGAATTCACACAAATTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 230
1007454620_1007454623 -3 Left 1007454620 6:41966848-41966870 CCTCTACAGCATGAATAATTGAG 0: 1
1: 0
2: 0
3: 8
4: 171
Right 1007454623 6:41966868-41966890 GAGAATTCACACAAATTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 230
1007454616_1007454623 7 Left 1007454616 6:41966838-41966860 CCCCTTAAGCCCTCTACAGCATG No data
Right 1007454623 6:41966868-41966890 GAGAATTCACACAAATTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 230
1007454617_1007454623 6 Left 1007454617 6:41966839-41966861 CCCTTAAGCCCTCTACAGCATGA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1007454623 6:41966868-41966890 GAGAATTCACACAAATTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 230
1007454619_1007454623 -2 Left 1007454619 6:41966847-41966869 CCCTCTACAGCATGAATAATTGA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1007454623 6:41966868-41966890 GAGAATTCACACAAATTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007454623 Original CRISPR GAGAATTCACACAAATTCTG GGG Intronic