ID: 1007459455

View in Genome Browser
Species Human (GRCh38)
Location 6:42007379-42007401
Sequence GTCCAATTGAAGTCAGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007459452_1007459455 2 Left 1007459452 6:42007354-42007376 CCATGAGGGTGGCTAGTAAGGCC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 1007459455 6:42007379-42007401 GTCCAATTGAAGTCAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007459455 Original CRISPR GTCCAATTGAAGTCAGGACA AGG Intronic
No off target data available for this crispr