ID: 1007459672

View in Genome Browser
Species Human (GRCh38)
Location 6:42009048-42009070
Sequence TAAGGTATACAGAAGTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007459669_1007459672 -8 Left 1007459669 6:42009033-42009055 CCATCCAAATGTAGCTAAGGTAT 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG No data
1007459668_1007459672 -7 Left 1007459668 6:42009032-42009054 CCCATCCAAATGTAGCTAAGGTA 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG No data
1007459666_1007459672 0 Left 1007459666 6:42009025-42009047 CCAGAGTCCCATCCAAATGTAGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG No data
1007459664_1007459672 18 Left 1007459664 6:42009007-42009029 CCGCCTTCTTCTCTTAAGCCAGA 0: 1
1: 0
2: 2
3: 32
4: 317
Right 1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG No data
1007459665_1007459672 15 Left 1007459665 6:42009010-42009032 CCTTCTTCTCTTAAGCCAGAGTC 0: 1
1: 0
2: 0
3: 21
4: 285
Right 1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007459672 Original CRISPR TAAGGTATACAGAAGTGTAA GGG Intronic
No off target data available for this crispr