ID: 1007459830

View in Genome Browser
Species Human (GRCh38)
Location 6:42009989-42010011
Sequence GCTTAGCCTGCATTCCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007459830_1007459833 4 Left 1007459830 6:42009989-42010011 CCTCCAAGGAATGCAGGCTAAGC 0: 1
1: 0
2: 0
3: 2
4: 115
Right 1007459833 6:42010016-42010038 AGAACCTTTGTTCTAGAATGTGG 0: 1
1: 0
2: 1
3: 32
4: 202
1007459830_1007459835 10 Left 1007459830 6:42009989-42010011 CCTCCAAGGAATGCAGGCTAAGC 0: 1
1: 0
2: 0
3: 2
4: 115
Right 1007459835 6:42010022-42010044 TTTGTTCTAGAATGTGGATTTGG 0: 1
1: 0
2: 1
3: 34
4: 284
1007459830_1007459836 11 Left 1007459830 6:42009989-42010011 CCTCCAAGGAATGCAGGCTAAGC 0: 1
1: 0
2: 0
3: 2
4: 115
Right 1007459836 6:42010023-42010045 TTGTTCTAGAATGTGGATTTGGG 0: 1
1: 1
2: 2
3: 28
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007459830 Original CRISPR GCTTAGCCTGCATTCCTTGG AGG (reversed) Intronic
900163476 1:1235522-1235544 GCTTGACCTGCATTCCCTGCCGG - Intergenic
902220500 1:14961462-14961484 GCTCAGCCTGGTTTCCCTGGAGG + Intronic
903261411 1:22133630-22133652 GCTAAGCCTGTACTCCGTGGTGG - Intronic
903950359 1:26993059-26993081 GCTGAGCCTGCAAACCTTGGTGG - Intergenic
906962730 1:50428207-50428229 GCTTGGCACGCAGTCCTTGGGGG + Intergenic
912087051 1:106020885-106020907 GCTTAGCATTCATTACTTAGAGG + Intergenic
916527643 1:165626669-165626691 CCTTTTCCTTCATTCCTTGGAGG - Intergenic
917430846 1:174967116-174967138 GCTTACGCTGCCTTCCTTGTAGG - Intronic
919307221 1:195856726-195856748 GCTTAGGCTGCACTTCTTTGTGG - Intergenic
920205146 1:204286018-204286040 CCTAAGCCTGCTGTCCTTGGTGG - Intronic
924660157 1:246008422-246008444 GCTTAGCCTGAGTTTCTGGGAGG + Intronic
1064035422 10:11909869-11909891 GCCTAGACTGCCTTCCCTGGAGG - Intergenic
1065108194 10:22412176-22412198 CTTTATCCTGCATGCCTTGGGGG - Intronic
1066452576 10:35544675-35544697 GCTGAGCCTGCTTTCCTTCTGGG - Intronic
1076977211 11:182926-182948 GCTTAACATGCAATCCTTTGAGG - Intronic
1086279484 11:85170007-85170029 GCTTAGCCAGGAATCCTAGGTGG - Intronic
1087652117 11:100879902-100879924 GCTTATCCTGGATTCTTTGTGGG + Intronic
1088781643 11:113140454-113140476 TCTCAGGCTGCCTTCCTTGGGGG - Intronic
1089033589 11:115360511-115360533 GCTTAACCTGCATGCCTTTTTGG - Intronic
1089254165 11:117185420-117185442 GCTAAGGCAGCAGTCCTTGGTGG + Intronic
1093817866 12:23571368-23571390 TCTTAGCCTTCATTCCTCAGAGG - Intronic
1098828222 12:75326816-75326838 GATTATCCTGGATTCTTTGGTGG + Intronic
1099421817 12:82471259-82471281 GATTAGTCTGCATTCCTGTGTGG + Intronic
1101203351 12:102460077-102460099 GCTGAGCCTGCATTCTTGAGTGG - Intronic
1102302292 12:111779676-111779698 TCTCTGCCTGCCTTCCTTGGGGG - Intronic
1105768723 13:23586971-23586993 GTCTAGCATGCATTTCTTGGAGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1113892059 13:113741411-113741433 GCTGAGCCTGCAGCCCTTGCTGG - Intergenic
1114143777 14:19948722-19948744 GCTTAGGCTCGATTCCATGGTGG + Intergenic
1117568300 14:57019240-57019262 TCTCAGACTGCATTCTTTGGGGG + Intergenic
1118525318 14:66634404-66634426 GCTTAGCCTGCAGTTGTTTGTGG + Intronic
1119651264 14:76385295-76385317 GTCTTGCTTGCATTCCTTGGGGG - Intronic
1119776471 14:77252219-77252241 TCTTGGCCTCCAGTCCTTGGAGG - Intronic
1121063615 14:90939926-90939948 GATTAGCTTGCATTCCTTTTTGG - Intronic
1121962930 14:98277862-98277884 GCTAAGCCTGCCTTGCCTGGTGG + Intergenic
1124620215 15:31269639-31269661 GCCCAGACTGCATTCTTTGGGGG - Intergenic
1127834847 15:62782689-62782711 GCTCAGTGTGCGTTCCTTGGCGG + Intronic
1132065537 15:98727843-98727865 GCCTGGCCCGCATTCCTTCGGGG - Intronic
1132247140 15:100306409-100306431 GCTTGGCGTCCATACCTTGGTGG - Intronic
1134343141 16:13363739-13363761 GATAAGCATGCATTGCTTGGTGG + Intergenic
1135970468 16:27068529-27068551 ACTTAGTCTGGACTCCTTGGGGG - Intergenic
1142443045 16:90113754-90113776 GCTTAACATGCAATCCTTTGAGG + Intergenic
1142464349 17:121095-121117 GCTTAACATGCAATCCTTTGAGG - Intergenic
1145233638 17:21193105-21193127 GGTAAACCTGCATTCCTTTGAGG - Intronic
1147331278 17:39700710-39700732 GCCTGGGCTGGATTCCTTGGGGG + Intronic
1149381440 17:56098007-56098029 GCTTATCCTGGATTCTTGGGTGG + Intergenic
1152007841 17:77693648-77693670 CCTTAGCGTGCATTCCATGTGGG - Intergenic
1154325490 18:13387788-13387810 GCTTTGCCTCCACTCCTGGGAGG + Intronic
1154461744 18:14596771-14596793 GCTTAGGCTCAATTCCATGGTGG + Intergenic
1159152688 18:64540161-64540183 GCTGAGGCTGCATTCCCAGGAGG - Intergenic
1164788409 19:30956201-30956223 GCTCAGCCTGAATGCCTAGGTGG - Intergenic
1167342247 19:48922741-48922763 TCTGAGCCTGCGTTCCTAGGTGG + Exonic
1167661335 19:50797749-50797771 GCTTGGCCTGCAGTGCTTTGGGG + Exonic
927214106 2:20656760-20656782 GCTAAGGCTGCAGACCTTGGTGG + Intergenic
927618666 2:24627903-24627925 GATTAGCCTCTATTACTTGGAGG - Intronic
930574833 2:53133743-53133765 GATTAGCTTGCATTATTTGGGGG - Intergenic
931769071 2:65481942-65481964 GCCCAGCCTGGATTCCTGGGAGG - Intergenic
937281303 2:120719254-120719276 GTTTAGGATGCATTTCTTGGAGG + Intergenic
937680918 2:124643609-124643631 GCTTGGACTTCATTCCTTAGAGG - Intronic
938621227 2:133055877-133055899 GCTTTGCCTGCCTTGCTTAGAGG + Intronic
946631739 2:221676992-221677014 GCTTAGCCAGCCTCCTTTGGTGG - Intergenic
949020639 2:241739243-241739265 GCCTGGCCTGCATTCTTGGGGGG + Intronic
1170190391 20:13639310-13639332 GTTCAGCCTGCATTGCTTGTAGG + Intergenic
1170450378 20:16477242-16477264 GTTTAGCCTGGATTCCTTCCTGG + Intronic
1173104012 20:40114881-40114903 GCTTAGCATGTATTACTTGATGG + Intergenic
1175444758 20:59012380-59012402 TCCTGGGCTGCATTCCTTGGAGG - Intergenic
1175547228 20:59786187-59786209 GGCTAGCCTGCACTCCCTGGGGG - Intronic
1175903950 20:62370834-62370856 GCTCTGCCTCCATTCCTTTGAGG - Intergenic
1176812810 21:13561820-13561842 GCTTAGGCTCAATTCCATGGTGG - Intergenic
1180968711 22:19803753-19803775 GGTTGGCCTGCATTCCTGGTTGG - Intronic
1182771137 22:32797117-32797139 GCTCAGCCTGCAGTCCTGGTCGG - Intronic
1183032114 22:35114039-35114061 GCTAAGCCTGGACTCTTTGGGGG + Intergenic
1183144747 22:35979986-35980008 TGTTAGCCTGAATTCCTTGAGGG - Intronic
1184496132 22:44842687-44842709 GCCCAGCCTGGCTTCCTTGGGGG + Intronic
1184949348 22:47829304-47829326 GATTATCCTGGATTCCCTGGAGG - Intergenic
1185281171 22:49970529-49970551 GAGTTGCCTGCATTCCTGGGTGG - Intergenic
954375576 3:50192570-50192592 GCTTAGCCTCTCTGCCTTGGGGG - Intronic
962000065 3:131286599-131286621 GCTTAGCCTGTAGTACCTGGTGG - Intronic
963042807 3:141081736-141081758 GCTGAGCCTCCATTTCTTTGTGG + Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
968363360 3:198165132-198165154 GCTTAACATGCAATCCTTTGAGG + Intergenic
970027111 4:11635316-11635338 GCTTTGCCTGCCTTGCATGGGGG + Intergenic
970756023 4:19428185-19428207 CCTTAGCCTTCACTTCTTGGTGG - Intergenic
976522921 4:86050638-86050660 GCTTAGCCTTCCATTCTTGGGGG + Intronic
982408676 4:155047884-155047906 TCTTAGCTTGTATTACTTGGTGG - Intergenic
984760635 4:183359948-183359970 TGGTGGCCTGCATTCCTTGGTGG - Intergenic
985681593 5:1258567-1258589 GCTGGGCCTGCACCCCTTGGTGG + Intronic
989638931 5:43564679-43564701 GCCTAGGCTGCATTCCCAGGAGG + Intergenic
991215550 5:64154748-64154770 GCTTCCCCTGCATTCTTTAGGGG - Intergenic
992144059 5:73827101-73827123 GCTCATCCTTCAGTCCTTGGAGG + Intronic
1005055671 6:21726649-21726671 GCTCTGCCTGCTTTCCATGGAGG + Intergenic
1007459830 6:42009989-42010011 GCTTAGCCTGCATTCCTTGGAGG - Intronic
1008439993 6:51521628-51521650 GCTTAGCCTGAACTGGTTGGAGG - Intergenic
1014594061 6:123310968-123310990 GCTTTCCCTTCAGTCCTTGGGGG - Intronic
1019252340 7:23541-23563 GCTTAACATGCAATCCTTTGAGG - Intergenic
1019335766 7:481767-481789 GCTTCACCTGCATCCCTTGCTGG + Intergenic
1023739137 7:43262652-43262674 GGTTAACATGCATTCCTAGGGGG + Intronic
1024841119 7:53588740-53588762 GCTTAGCCTGCATTTATAAGTGG - Intergenic
1027417206 7:77985847-77985869 TCTTGGCCTGCTTCCCTTGGGGG + Intergenic
1027938231 7:84636932-84636954 GCTTAGGCTGCATTTGTTAGTGG + Intergenic
1031586598 7:123538183-123538205 ACTCAGCCTGGATTCCTTGTGGG + Exonic
1033646968 7:143312484-143312506 GGTAACACTGCATTCCTTGGAGG - Intergenic
1041427720 8:57741540-57741562 GCTCAGCCTCCATCCTTTGGGGG - Intergenic
1042030377 8:64469625-64469647 GCTTAGCCTGCAGTTTTTGGTGG - Intergenic
1046317473 8:112524542-112524564 TCTTAGCCTGTGTTCCTTGAAGG - Intronic
1048952915 8:139510884-139510906 GCCTAGGCTGCATTCCCTTGTGG + Intergenic
1050758046 9:9032535-9032557 ACATTGCCTGCAGTCCTTGGGGG - Intronic
1051997763 9:23238603-23238625 GCTTAGACTGCAGTTGTTGGTGG - Intergenic
1060657205 9:125380370-125380392 GCTGAGCCAGCAGACCTTGGGGG + Intergenic
1062049843 9:134441716-134441738 GCTGAGCCAGCCTCCCTTGGTGG + Intergenic
1062118501 9:134821806-134821828 GCTCAGCCTGAAGTCCTCGGTGG + Intronic
1062534234 9:137014538-137014560 GGTTAGCCTGCGGTCCTAGGTGG - Intronic
1062748002 9:138228374-138228396 GCTTAACATGCAATCCTTTGAGG + Intergenic
1188557260 X:31426731-31426753 TCTTAGGCTGCATTCTTAGGGGG + Intronic
1189888624 X:45576544-45576566 GCTTAGGCTGCAGTCGTTAGTGG + Intergenic
1192699761 X:73456162-73456184 AATTAGGCTGCATTCCTAGGTGG - Intergenic
1195146988 X:102027600-102027622 GCTTAGCCTGCAGTTATTAGTGG - Intergenic
1196759679 X:119190123-119190145 CCTTAGCCTGCCTTCCAGGGAGG - Intergenic