ID: 1007460312

View in Genome Browser
Species Human (GRCh38)
Location 6:42013321-42013343
Sequence GAACCATGGTTAACTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007460309_1007460312 4 Left 1007460309 6:42013294-42013316 CCAACTTAAACCACGGTTTTCTC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1007460312 6:42013321-42013343 GAACCATGGTTAACTGCCATTGG No data
1007460310_1007460312 -6 Left 1007460310 6:42013304-42013326 CCACGGTTTTCTCTTGTGAACCA 0: 1
1: 0
2: 0
3: 16
4: 218
Right 1007460312 6:42013321-42013343 GAACCATGGTTAACTGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007460312 Original CRISPR GAACCATGGTTAACTGCCAT TGG Intronic
No off target data available for this crispr