ID: 1007461988

View in Genome Browser
Species Human (GRCh38)
Location 6:42025706-42025728
Sequence CTTGTGACTCAGAGCCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007461988_1007461993 7 Left 1007461988 6:42025706-42025728 CCTTTTGGGCTCTGAGTCACAAG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1007461993 6:42025736-42025758 CTCTCAGAGCTGTGATGGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 197
1007461988_1007461995 23 Left 1007461988 6:42025706-42025728 CCTTTTGGGCTCTGAGTCACAAG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1007461995 6:42025752-42025774 GGCCTGGTCTCTCCTCCCCAGGG 0: 1
1: 0
2: 4
3: 38
4: 383
1007461988_1007461997 26 Left 1007461988 6:42025706-42025728 CCTTTTGGGCTCTGAGTCACAAG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1007461997 6:42025755-42025777 CTGGTCTCTCCTCCCCAGGGAGG No data
1007461988_1007461994 22 Left 1007461988 6:42025706-42025728 CCTTTTGGGCTCTGAGTCACAAG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1007461994 6:42025751-42025773 TGGCCTGGTCTCTCCTCCCCAGG 0: 1
1: 1
2: 0
3: 39
4: 404
1007461988_1007461992 2 Left 1007461988 6:42025706-42025728 CCTTTTGGGCTCTGAGTCACAAG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1007461992 6:42025731-42025753 TGGCTCTCTCAGAGCTGTGATGG 0: 1
1: 0
2: 1
3: 24
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007461988 Original CRISPR CTTGTGACTCAGAGCCCAAA AGG (reversed) Intronic
906643133 1:47453512-47453534 ATAGTCACTCAGAGACCAAATGG + Intergenic
908381113 1:63597567-63597589 CGTGTTAGTCAGAGCCCAATTGG + Intronic
910853491 1:91671080-91671102 CTTGGCACTCAGAGCCCTAAGGG - Intergenic
911717470 1:101150401-101150423 GTTGTGAGTAATAGCCCAAAAGG - Intergenic
913646574 1:120861249-120861271 CTTGTGGCTCATAGCCACAAGGG + Intergenic
913940940 1:125104249-125104271 CTTGTGATTCAGAATACAAATGG + Intergenic
914080074 1:144401623-144401645 CTTGTGGCTCATAGCCACAAGGG - Intergenic
914174980 1:145270158-145270180 CTTGTGGCTCATAGCCACAAGGG - Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914529705 1:148511637-148511659 CTTGTGGCTCATAGCCACAAGGG - Intergenic
917018225 1:170558643-170558665 CTTGAGACTGAGAGACTAAATGG - Intergenic
918293567 1:183133526-183133548 CCAGTGTCTCAGAGTCCAAAGGG - Exonic
922542516 1:226429805-226429827 CTTCTGGCTCAGACCCCGAATGG - Intergenic
1063020501 10:2122395-2122417 CTTGTGAACCACAGCCTAAATGG + Intergenic
1067243810 10:44519060-44519082 CTGGTGGCTCAGTCCCCAAAAGG + Intergenic
1069111475 10:64452865-64452887 CTTTTGCCCCTGAGCCCAAATGG + Intergenic
1069262531 10:66415644-66415666 CTTGGGACTCAGAGGTCAAGTGG - Intronic
1069979794 10:72244338-72244360 GTTTTGGCTCAGAGCCCAGAAGG - Intergenic
1072569312 10:96644462-96644484 CTTGTGACTCCCAGCCAATATGG - Intronic
1073848001 10:107581435-107581457 AATGTGACTCAAAGCCTAAAGGG - Intergenic
1074760952 10:116667145-116667167 CTTGTGACACAGAGACAAAGGGG + Intronic
1076125363 10:127969906-127969928 CTTGTGACTCAGGGTCCCCATGG - Intronic
1078449652 11:11431054-11431076 CATATGACTTAGAGTCCAAATGG + Intronic
1079343118 11:19629311-19629333 CTTCTGGCTCAGGGACCAAAGGG + Intronic
1083322864 11:61857838-61857860 CATGGGACTCAGGGCCCACAGGG - Intronic
1085181963 11:74543630-74543652 GGTGTGATTCAGAGCCCAAGCGG - Intronic
1086761749 11:90639765-90639787 CTTGTGATACAGAGCCAAATAGG + Intergenic
1087611095 11:100434873-100434895 CTTATGTCTCAGAGCTTAAATGG - Intergenic
1091779332 12:3204126-3204148 CTTGTGGCTCAGATCCAAAAAGG + Intronic
1094821926 12:34232683-34232705 CTTCTGACTCAGATTCCCAAAGG - Intergenic
1095922980 12:47549483-47549505 CTTTTGAGTCAGAGCCTAGAAGG + Intergenic
1097071271 12:56356568-56356590 CTTCTGACGCAGAGCCCAAATGG - Exonic
1101312707 12:103598090-103598112 TTTGTCACTCAGAGCAAAAAAGG - Intronic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1108020321 13:46121489-46121511 CTTGAGACTCAGTGCCTATAGGG - Intergenic
1109224791 13:59680053-59680075 CTTGTGACCAAGAAACCAAATGG - Intronic
1109788756 13:67219306-67219328 CTGGTGACTGACAGCCCAATAGG + Intronic
1110466231 13:75805416-75805438 TTTGTGACACAGAACACAAATGG - Intronic
1111650369 13:91082870-91082892 CTTGTGATTAACAGGCCAAAGGG + Intergenic
1113032021 13:106004208-106004230 CTTCTGACTCAGAGTCGGAAGGG - Intergenic
1117255364 14:53971682-53971704 CTTATGACTCAGTGACCAGAAGG - Intergenic
1120920313 14:89749071-89749093 CTGGTGACTCAGGGCTCCAAAGG + Intergenic
1121906294 14:97749486-97749508 CTTGTGATTCAAAACCCAACTGG - Exonic
1123947212 15:25244593-25244615 CTTGAGATTCAGTGGCCAAAAGG + Intergenic
1124964600 15:34423781-34423803 TGTGTGACTCAGTGGCCAAAGGG - Intronic
1124981221 15:34570008-34570030 TGTGTGACTCAGTGGCCAAAGGG - Intronic
1132119862 15:99167407-99167429 CTTGTAAATCTGAGCCCTAATGG + Intronic
1137621500 16:49879459-49879481 CATGTAACTCAGAGCCAAGAGGG + Intergenic
1139952276 16:70678220-70678242 CTGGGGACTCAGACCCCAGAGGG - Intronic
1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG + Intergenic
1143170343 17:4925847-4925869 CCTGTTACCCAGAGCCCAGACGG - Intergenic
1143171171 17:4931483-4931505 CATGTGTCACAGAGGCCAAAAGG + Intergenic
1144297174 17:13887159-13887181 CTTGTCCCTCTGAGCCCAGAGGG - Intergenic
1146509719 17:33436478-33436500 CTTGTGACTCATGGCTCAACTGG + Intronic
1146660511 17:34662553-34662575 CTCATGACTCACAGCCCAACTGG + Intergenic
1147664337 17:42136695-42136717 ATTGGTAGTCAGAGCCCAAAAGG + Intronic
1153489976 18:5636692-5636714 CTTGAGAGTCTGAGGCCAAATGG + Intergenic
1156501068 18:37558693-37558715 CTTGTTATAGAGAGCCCAAAAGG + Intronic
1159562041 18:70006390-70006412 ATTGTAAATCAGAGCCCAAAGGG + Exonic
1162805726 19:13137154-13137176 CTTGGGACCCAGAGCCCAGCAGG + Intronic
1163152824 19:15425052-15425074 CTGCTGAGTCACAGCCCAAAGGG + Intronic
1164100711 19:22052361-22052383 CCTGTCACTCAGGGCCTAAAGGG + Intergenic
1164518825 19:28961142-28961164 CTTGTGACTCATAACTCAACCGG + Intergenic
1165141471 19:33702725-33702747 CGTGTGAGTCACAGCCCAGAGGG + Intronic
1165312518 19:35037432-35037454 CCTGGAACTCAGTGCCCAAATGG - Intronic
1168273490 19:55263100-55263122 TTTGTGATTCATAGCACAAATGG + Intronic
926287861 2:11504872-11504894 GTTGTTACTCAGAGCCAATAAGG - Intergenic
928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG + Intergenic
928829163 2:35458197-35458219 CTTGTGACGGAGAGGACAAAAGG - Intergenic
930404685 2:50940535-50940557 CTTGTGACCCAGAGAGCACAAGG - Intronic
931664668 2:64601661-64601683 CTGGTGACACAGAGCCCATGTGG - Intergenic
932802524 2:74754121-74754143 CTTTAGACTGAGACCCCAAAGGG + Intergenic
932842072 2:75092693-75092715 CTGGAGACTCAGAGCCCCACTGG + Intronic
934224821 2:90122815-90122837 CTTGTGTCTCATTGCTCAAAGGG - Intergenic
937012480 2:118574648-118574670 TCTGAGACTCAGACCCCAAATGG - Intergenic
938265326 2:129923897-129923919 CCTGTGACTGAGTGCCAAAAAGG - Intergenic
938343886 2:130553160-130553182 CTTGTGACTCATGACTCAAATGG + Intergenic
938345947 2:130567562-130567584 CTTGTGACTCATGACTCAAATGG - Intergenic
942094168 2:172522226-172522248 CTTGTGACTCAGGGCTCAGGGGG + Intergenic
942550116 2:177106993-177107015 CTTTTGAGTAAGAGCCCAAAGGG - Intergenic
943532765 2:189105690-189105712 ATTCTGACTCAAAGCCCAGAAGG - Intronic
943638298 2:190330832-190330854 TTTATGACTAAGACCCCAAAAGG + Intronic
948373933 2:237508587-237508609 CTTGTGACTCACCCCCCTAAAGG + Intronic
948987854 2:241536329-241536351 TTCGTGACTCAGATCCCAGAGGG + Intergenic
1169055933 20:2621037-2621059 CTTGTGACTTAGGGCCCACCTGG - Intronic
1174328220 20:49796624-49796646 CTTCTGATTCAGAGCCAAGAGGG - Intergenic
1174558306 20:51412339-51412361 CTTGTGACTCAGAATGCAGACGG - Intronic
1181099649 22:20530794-20530816 CAGGTGACTCAGAGCTCCAATGG + Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
949130351 3:492648-492670 ACTGTGACTCAGAAACCAAAAGG + Intergenic
949234710 3:1794001-1794023 TTTGTTACTCAGATCCCAAGAGG - Intergenic
959724821 3:109531438-109531460 CTATTGACTCAGAGCACAGAAGG + Intergenic
960024283 3:112990699-112990721 CTTGAGACTCAAAGGCCACATGG + Intergenic
962313307 3:134341132-134341154 CTTGGGACTTAGAGGGCAAATGG + Intergenic
963989454 3:151636184-151636206 TTTGTTACTCAGAGCCCAGCAGG - Intergenic
964744095 3:159996361-159996383 CTTTTCTCTCAGAGCCCAAAGGG - Intergenic
964793538 3:160474636-160474658 CTTCTGCCTCAGAGTCTAAAAGG + Intronic
966200046 3:177352696-177352718 CTGGTGGCTCAGAGCCCATGTGG - Intergenic
967821384 3:193842422-193842444 CTTGAGATTCTGAGCCCAAGAGG + Intergenic
969171351 4:5366421-5366443 CCTGTGACTCAGAGATCAAGTGG - Intronic
970690995 4:18620587-18620609 TTTGTGAGTCAAAGACCAAATGG + Intergenic
971046494 4:22810917-22810939 TTTGGGACTCAGAGCCCAGTTGG + Intergenic
971409688 4:26357059-26357081 CTTGTGAAGGTGAGCCCAAAAGG + Intronic
972614466 4:40684951-40684973 TTTGTGACCCAGTTCCCAAATGG - Intergenic
972719682 4:41683489-41683511 CTGGTAACTCAGAGCCCCAGAGG - Intronic
974489246 4:62543627-62543649 CTTGTGACTAAGTGGCCACAAGG - Intergenic
975261262 4:72302413-72302435 ATAGTGACTTAGAGCTCAAAAGG + Intronic
980989335 4:139725536-139725558 TCTGTGACTCAGTGACCAAAAGG + Intronic
984333020 4:178350963-178350985 ATTGTGATTCAGAGTCCGAAAGG + Intergenic
989977444 5:50602938-50602960 CTTGTGGCTCATAGCCACAAGGG + Intergenic
992344670 5:75864801-75864823 CTGTTGCCTCAGAACCCAAAAGG - Intergenic
993766584 5:91866426-91866448 CTTGTGACTCAGAACACAAATGG + Intergenic
1000019821 5:157309581-157309603 CATGTGACTCTGAAGCCAAACGG - Intronic
1000026567 5:157363845-157363867 CTTCTGAATCAGAGCCAGAAAGG + Intronic
1000454913 5:161437467-161437489 CTGGTTAGTCAGGGCCCAAAGGG - Intronic
1003111918 6:3258331-3258353 CTTGGGACTCGGCGTCCAAAAGG + Intronic
1003613729 6:7636267-7636289 ATTGTGACTCAGACCTCCAAAGG + Intergenic
1006577903 6:35059402-35059424 CTTGAGCCTCTGAGCACAAAGGG + Intronic
1006835035 6:36992961-36992983 CTTGGGACTGAGAGGCCCAAAGG + Intergenic
1007461988 6:42025706-42025728 CTTGTGACTCAGAGCCCAAAAGG - Intronic
1009964742 6:70566686-70566708 CTTGTCAGTCTGAGCCGAAATGG - Intergenic
1015307060 6:131721320-131721342 AATGTGACTTAGAGACCAAAAGG + Intronic
1016607014 6:145941238-145941260 CTTTTAAATCAGAGGCCAAATGG - Intronic
1018039193 6:159906633-159906655 CTTGTGGCTTAGTGCCAAAAAGG - Intergenic
1020932730 7:14419450-14419472 ATTGTAACTAAAAGCCCAAAAGG - Intronic
1021234433 7:18124833-18124855 CTTCTGCCTCTGATCCCAAAAGG + Intronic
1024684016 7:51725418-51725440 CTTGGGGCTCAGATTCCAAAAGG + Intergenic
1025230990 7:57203269-57203291 CTTGAGACTGGGAGCCCAACTGG - Intergenic
1027669577 7:81078841-81078863 TTTGTGACTTAGAGCTCCAAGGG + Intergenic
1032367507 7:131314332-131314354 CTAATGACTCAGACCCCTAAAGG - Intronic
1032699319 7:134364831-134364853 ATTCTGACTCAGTGCCCAACTGG + Intergenic
1039760947 8:40574719-40574741 CGTTTGACTCAGAGCCAAGAAGG + Intronic
1041459073 8:58091777-58091799 CTTGTAACCCAGAGACCACATGG - Intronic
1042991514 8:74645667-74645689 CTTGAAACTTAAAGCCCAAACGG + Intronic
1047151780 8:122272187-122272209 TTTGTGAATCAGAGCTTAAAGGG - Intergenic
1049112690 8:140657954-140657976 CTAGGGACTCAGACTCCAAAGGG - Intronic
1053414395 9:37937937-37937959 TTGGGGAGTCAGAGCCCAAAGGG - Intronic
1054854840 9:69887802-69887824 CTGGTGGCTCAGAGCTTAAAAGG - Intronic
1055208540 9:73762339-73762361 CTTGGGACTGAGATCCCAGAAGG + Intergenic
1056544338 9:87601352-87601374 CTTGTGACTCTGAGCTCCCAAGG + Intronic
1057716580 9:97501203-97501225 CTTGCGGCTCAGAGCCCACCTGG + Intronic
1058683724 9:107462880-107462902 CCTGTGAGTCAGAGAGCAAAAGG + Intergenic
1060193195 9:121606003-121606025 GTTGAGTCTCAGAGGCCAAAAGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061603360 9:131687904-131687926 CTTGTTCCTCACAGCCCATAGGG - Intronic
1062378853 9:136277154-136277176 CTTGTCAGTCAGAGCCCAGTGGG + Intergenic
1186491406 X:9976300-9976322 TTTGTAACTGAGAGCACAAAGGG - Intergenic
1190444102 X:50505764-50505786 ATTGAGACTCAGAGGCCCAAAGG + Intergenic
1193553698 X:82929353-82929375 CTTGGGAACCAGAGCCTAAAAGG + Intergenic
1194519689 X:94902660-94902682 CATATGACTCAGAGGCAAAATGG - Intergenic
1197726120 X:129777603-129777625 CTGGTCACGCAGAGCCCCAAAGG + Intergenic
1199258337 X:145743301-145743323 CAAGTGCCTCAGAGCCTAAAAGG + Intergenic