ID: 1007464794

View in Genome Browser
Species Human (GRCh38)
Location 6:42044178-42044200
Sequence AGGCTCCGGCCAGAACGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464794_1007464801 8 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464801 6:42044209-42044231 CAGAAGAGCACCTTTTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1007464794_1007464798 5 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464798 6:42044206-42044228 AGACAGAAGAGCACCTTTTACGG 0: 1
1: 1
2: 0
3: 21
4: 199
1007464794_1007464802 17 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464802 6:42044218-42044240 ACCTTTTACGGGGGCTTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1007464794_1007464800 7 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464800 6:42044208-42044230 ACAGAAGAGCACCTTTTACGGGG No data
1007464794_1007464799 6 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464799 6:42044207-42044229 GACAGAAGAGCACCTTTTACGGG 0: 1
1: 0
2: 1
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464794 Original CRISPR AGGCTCCGGCCAGAACGTGC AGG (reversed) Intronic
900477099 1:2881150-2881172 AGGCTCCGGCCAGCGTGTGCGGG + Intergenic
901032136 1:6313328-6313350 AGGTTGCGGCCAGAAAGTGGAGG + Intronic
901778450 1:11576637-11576659 AGGCTTGGGCCAGCAGGTGCTGG - Intergenic
902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG + Intronic
905925235 1:41745035-41745057 AAGCTCCAGCCAGAACCTGGGGG + Intronic
921757236 1:218872890-218872912 AGGCTGGGGCCAGAGTGTGCAGG + Intergenic
1074188650 10:111117115-111117137 AGGCCGAGGCCAGAACGTTCAGG + Intergenic
1076516272 10:131046549-131046571 AGGCGTCAGCCAGAAAGTGCGGG - Intergenic
1077468244 11:2743961-2743983 CGGATCAGGCCAGAACGGGCAGG - Intronic
1080866986 11:36204205-36204227 AGGCTCTGGGCAGAACATCCTGG + Intronic
1083794543 11:65007546-65007568 AGGCACCAGCAAGCACGTGCTGG - Intergenic
1103193472 12:119022136-119022158 AGGATACGGGCAGAATGTGCAGG - Intronic
1123179007 14:106450152-106450174 AGGTCCCAGCCAGAGCGTGCAGG - Intergenic
1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG + Intergenic
1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG + Intronic
1126780219 15:52133415-52133437 GCGCTCCGGCCAGTGCGTGCAGG - Exonic
1129641478 15:77383165-77383187 AGGCTCCCGCCACCACGTCCAGG + Intronic
1129711887 15:77824669-77824691 AGGCTCCAGACAGAAGGGGCTGG + Intergenic
1132680792 16:1140955-1140977 AGGTCCCGGCCAGCACGTCCTGG + Intergenic
1136402561 16:30026535-30026557 AGGCTCCTGCCAGCACCAGCAGG + Intronic
1140318545 16:73923821-73923843 AGGCTCCAGGCAGTATGTGCTGG + Intergenic
1142196954 16:88743358-88743380 AAGCTCCTGCCAGCACGTGCCGG - Intronic
1143514502 17:7413076-7413098 AGATTCCGGCCTGAAAGTGCTGG + Intronic
1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG + Exonic
1149326186 17:55531991-55532013 AGGCTCAGACCAGAAAGTGAGGG - Intergenic
1152457994 17:80427004-80427026 AGGCCCCGGCCCGAAGGTGGTGG - Intronic
1153331391 18:3879111-3879133 ACGCTCCTGCCAGTACCTGCAGG - Exonic
1154124490 18:11678103-11678125 AGTCTACGGCTAGACCGTGCGGG - Intergenic
1159790938 18:72778074-72778096 AGACTACTGCCAGAAAGTGCCGG + Intronic
1160591542 18:79947607-79947629 AGGCTCCGGTGAGAAGGGGCTGG - Intronic
1161680736 19:5678510-5678532 CTGCCCCGGCCAGAACGGGCAGG - Exonic
1162381480 19:10334265-10334287 AGGCTCCAGCCGGGAGGTGCCGG - Exonic
1166762929 19:45235811-45235833 AGCCTCTGGCCAGAACGTGGAGG + Intronic
1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG + Intergenic
935251978 2:101271055-101271077 AGCCTCCGTCAGGAACGTGCGGG + Intergenic
944197794 2:197073535-197073557 TGGCTCTGACCAGAACTTGCTGG - Intronic
946431656 2:219629689-219629711 AGGCTGCAGCCAGTACCTGCTGG - Exonic
947729642 2:232420828-232420850 AGGCTCCGGCGCGCACCTGCCGG - Intergenic
1171352930 20:24518618-24518640 ACGCTCTGGGCAGAAGGTGCTGG + Intronic
1174420354 20:50395457-50395479 AGTCTCTGGCCAGAGCCTGCGGG + Intergenic
1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG + Intronic
1175388448 20:58611838-58611860 AGCCCCCGGCCAGAACCTGCAGG + Intergenic
1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG + Intronic
1179627413 21:42656485-42656507 AGGCCCCGGGCAGCAAGTGCCGG + Intronic
1180981820 22:19881924-19881946 AGGCTCCAGGCAGACCCTGCAGG - Intronic
1182089634 22:27585218-27585240 AGGCTAAGGCCAGAATGTGAAGG + Intergenic
1183409551 22:37646913-37646935 AGGCACCTGCCACAGCGTGCGGG - Exonic
1184301937 22:43566584-43566606 AAGCTCCTGCCAGCAGGTGCTGG + Intronic
1184948161 22:47818805-47818827 AGGCTAAGGGCAGAAAGTGCAGG + Intergenic
1185167013 22:49267414-49267436 AGCGTCCGGCCATCACGTGCGGG + Intergenic
955549430 3:60067804-60067826 AGGCAGCGACAAGAACGTGCTGG - Intronic
957293432 3:78306669-78306691 AGGCTTCTGCCAGGACATGCAGG - Intergenic
979489431 4:121308393-121308415 AGGCTCCGGGCTGAATTTGCAGG - Intergenic
985542340 5:492771-492793 AGGCTCTGGCCACAACGTCAGGG - Intronic
997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG + Intronic
998376139 5:141692195-141692217 AGGCTGCCGCCAGAGCGGGCAGG + Intergenic
1001543905 5:172558373-172558395 AGGCACGGCCCAGAACGTGCAGG + Intergenic
1006581536 6:35080419-35080441 AGCCCCAGGCCAGAACATGCAGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG + Intergenic
1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG + Intergenic
1019324884 7:433142-433164 TGGCTCCTACCAGAAAGTGCGGG - Intergenic
1019617886 7:1974813-1974835 AGGCCCCGGCCAGAGTGTTCGGG + Intronic
1028129454 7:87152728-87152750 AGGCCCTGGCCGGAACGTGCGGG - Exonic
1029702421 7:102256117-102256139 CGGCTCCGGCCAGAGCCCGCGGG - Exonic
1034136226 7:148772825-148772847 AGGCTACGTCCAGACCCTGCAGG - Intronic
1035281222 7:157779654-157779676 AGACTCTGGCCAGGACGAGCTGG + Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1049156706 8:141071677-141071699 TGCCTCCTGCCAGACCGTGCTGG + Intergenic
1049235858 8:141511942-141511964 AGGCTCCTGCCAGAACCTCTGGG + Intergenic
1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG + Intronic
1053218738 9:36294009-36294031 AGGCTGCAGTCAGAACCTGCTGG - Intronic
1054648013 9:67605452-67605474 CTGTTCCGGCCAGAAGGTGCTGG - Intergenic
1056590756 9:87964153-87964175 TGGCTCCTTCCAGAACATGCAGG + Intergenic