ID: 1007464796

View in Genome Browser
Species Human (GRCh38)
Location 6:42044192-42044214
Sequence CTTCTGTCTTGTCCAGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 286}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464796_1007464804 22 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464804 6:42044237-42044259 CTGGATCAAAAGCAGTTCTCTGG No data
1007464796_1007464801 -6 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464801 6:42044209-42044231 CAGAAGAGCACCTTTTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1007464796_1007464806 29 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464806 6:42044244-42044266 AAAAGCAGTTCTCTGGGCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 260
1007464796_1007464800 -7 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464800 6:42044208-42044230 ACAGAAGAGCACCTTTTACGGGG No data
1007464796_1007464805 23 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464805 6:42044238-42044260 TGGATCAAAAGCAGTTCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 179
1007464796_1007464799 -8 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464799 6:42044207-42044229 GACAGAAGAGCACCTTTTACGGG 0: 1
1: 0
2: 1
3: 6
4: 121
1007464796_1007464802 3 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464802 6:42044218-42044240 ACCTTTTACGGGGGCTTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1007464796_1007464798 -9 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464798 6:42044206-42044228 AGACAGAAGAGCACCTTTTACGG 0: 1
1: 1
2: 0
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464796 Original CRISPR CTTCTGTCTTGTCCAGGCTC CGG (reversed) Intronic
900409716 1:2507130-2507152 ATCCTGTCTGGGCCAGGCTCAGG + Intergenic
901787955 1:11637216-11637238 GCTGTGTCTGGTCCAGGCTCTGG - Intergenic
902334028 1:15744622-15744644 CCTCTGTCTGGGTCAGGCTCCGG + Intronic
903597666 1:24508083-24508105 TTTCACTCTTGTCCAGGCTGGGG - Intronic
904283385 1:29437109-29437131 CCTGTGGCTTTTCCAGGCTCGGG - Intergenic
905687593 1:39919764-39919786 CTTCTGTTTCCTCCAGCCTCAGG - Intergenic
906615076 1:47228522-47228544 CTTCTGTCTTGTTCTGGCACAGG - Intronic
907126063 1:52052268-52052290 TTTCTGTCTTGTTCATGCTCAGG - Intronic
907850713 1:58252206-58252228 CTTCTGTCCTGTCCAGGACCAGG + Intronic
908539748 1:65111399-65111421 CTTGTGGCTTTTCCAGGCTCAGG + Intergenic
911655414 1:100437356-100437378 TTTCTTTCTTGTCCAGTCTTTGG + Intronic
912040327 1:105382407-105382429 CTTCTGCTTGGTCCAGGCTAAGG + Intergenic
914461706 1:147891207-147891229 CTTCTGTGTTGGCCAGGATGGGG - Intergenic
914794306 1:150907062-150907084 CTTCTGCATTGTACAGGATCAGG - Intergenic
916812255 1:168315771-168315793 CTTCTGTCTGCTCCAGGCTAGGG - Intergenic
918059450 1:181048870-181048892 CTTACGTCCTGTCCAGGCCCCGG + Intronic
920502848 1:206496401-206496423 TTTCTATCTTCTCTAGGCTCAGG + Exonic
920637638 1:207719685-207719707 CTTGTTTGTTGTCCAGGCTGGGG - Intronic
922466240 1:225847006-225847028 CTGCTGGCTGGGCCAGGCTCAGG - Intronic
924122986 1:240821418-240821440 ACTCTGTCTTGCCCAGGCTGGGG - Intronic
1064308083 10:14186613-14186635 CTTCTCTCCTGTTCAGTCTCAGG + Intronic
1064439764 10:15343162-15343184 TTGCTGTGTTGTCCAGGCTCTGG - Intronic
1066109816 10:32185943-32185965 CAGCTGTCTTGTTCAGGCTCAGG + Intergenic
1066372634 10:34830147-34830169 CTCCTGCCTTTTCCAGGCCCTGG + Intergenic
1067890346 10:50129650-50129672 CTTCTGTCCACTCCAGGCACAGG - Exonic
1068292119 10:55016827-55016849 CTTCTGTCTTGTCTTGATTCTGG + Intronic
1068379635 10:56234374-56234396 TTTCTGCCTTTTCTAGGCTCTGG + Intergenic
1069872243 10:71540261-71540283 CTGCTTTCTGGTCCAGGGTCTGG - Intronic
1070357270 10:75652394-75652416 CTTCTGTCTTGGCCTGGCAGAGG - Intronic
1072726622 10:97817903-97817925 CTTGAGTCTTGGCCAGGCTAAGG + Intergenic
1073286104 10:102389503-102389525 TTGCTGTGTTGTCCAGGCTGGGG - Intergenic
1073440437 10:103549472-103549494 CTCCACTCTTGTCCTGGCTCTGG + Intronic
1073618736 10:105025060-105025082 CTTCTGTCTGGTCCCAGCACCGG - Intronic
1073772399 10:106749617-106749639 CTTCTTTGTTGTCCAGAATCAGG - Intronic
1075130436 10:119733649-119733671 CTTGTGTTTTGGCCAGGCCCTGG + Intronic
1075716737 10:124559956-124559978 CTGCTGTCTTGCCCAGCCCCAGG - Intronic
1076410507 10:130245591-130245613 CTTCTGTCTTGTTCCCCCTCAGG - Intergenic
1077273356 11:1692096-1692118 CTTCTGTCTGGGTCAGGGTCTGG - Intergenic
1077736789 11:4800017-4800039 CCTGTGGCTTTTCCAGGCTCAGG + Intronic
1078709169 11:13773973-13773995 CTTCTCTCTTGTCAATGTTCAGG + Intergenic
1079109917 11:17599611-17599633 TGTCTGTCTGTTCCAGGCTCTGG + Intronic
1080641641 11:34161914-34161936 CTGCTGTCTTGGCCCGGCCCTGG + Intronic
1080669476 11:34362979-34363001 CTGCTGTCTGTTCAAGGCTCAGG + Intergenic
1081537699 11:44007336-44007358 CTTCTTTCTCGCCCAGGCTCTGG - Intergenic
1081821959 11:46007343-46007365 TTTCACTCTTGTCCAGGCTGGGG + Intronic
1082190077 11:49232476-49232498 CTTCATTGTTGTCCAGACTCGGG - Intergenic
1084632114 11:70359882-70359904 CTTCAGCCATCTCCAGGCTCTGG + Intronic
1085537500 11:77232018-77232040 CTTCTGACCTGTTCAGGGTCAGG - Intronic
1085811031 11:79681237-79681259 CTTATGTCCTGGCCAGGGTCAGG - Intergenic
1086564661 11:88212008-88212030 CCTGTGTCTTTTCCAGGCTGAGG + Intergenic
1086676050 11:89608456-89608478 CTTCATTGTTGTCCAGACTCGGG + Intergenic
1086954380 11:92920653-92920675 CTGCTGCCTTGTCCTGGCTCTGG - Intergenic
1087554010 11:99690965-99690987 TTTCTTTCTTGTCCAGTCTTGGG + Intronic
1089263569 11:117240654-117240676 CTTCTCTGTTGTCCAGGCTGGGG - Intronic
1090726120 11:129528894-129528916 GTTCTGTACTGTCCAGGCCCAGG - Intergenic
1091601403 12:1919682-1919704 CTTCTGTCCTGGCCAGGCCTTGG - Intergenic
1092099018 12:5867902-5867924 CTACTGTCCTTCCCAGGCTCTGG - Intronic
1092147383 12:6223979-6224001 CCTCTGCCTTGTCCAGCCGCGGG + Intronic
1092661270 12:10740652-10740674 TTCCTCTCTTTTCCAGGCTCTGG + Intergenic
1093713602 12:22355731-22355753 AGGCTGTCTTGTCCAGCCTCTGG - Intronic
1095728108 12:45474320-45474342 CCTGTGGCTTTTCCAGGCTCAGG - Intergenic
1096157890 12:49351397-49351419 CCTCTGTCTGGTCCAGGTTGTGG - Exonic
1099031534 12:77531179-77531201 TTTCTGCCTTGTGCTGGCTCTGG + Intergenic
1099274147 12:80554051-80554073 CTCCTACCTTTTCCAGGCTCTGG - Intronic
1099598714 12:84703136-84703158 TTGCTGTGTTGTCCAGGCTATGG + Intergenic
1101598040 12:106184403-106184425 CATGTGGCTTGTCCAGGGTCAGG + Intergenic
1103549068 12:121723363-121723385 TTGCTGTGTTGCCCAGGCTCAGG + Intronic
1104800920 12:131554850-131554872 CTGCTGTCTTGTCCCTGCTGTGG - Intergenic
1106342827 13:28847552-28847574 CCTCTGTCTTGTTGTGGCTCTGG + Intronic
1108493963 13:51006380-51006402 CTTCTGTCTTAGCCAGGCTGTGG + Intergenic
1108751316 13:53450955-53450977 CCTCTGACTTGTCCATCCTCTGG - Intergenic
1109337356 13:61009331-61009353 CTTGTGAATTTTCCAGGCTCAGG - Intergenic
1110312613 13:74068586-74068608 CTGCTCTCTTGCCCAGGCTGGGG + Intronic
1111183379 13:84697380-84697402 CTTCTTTCTGGTTCAGCCTCGGG - Intergenic
1112029480 13:95443891-95443913 TTTCTGTATTCTCCATGCTCTGG - Intronic
1113615020 13:111674209-111674231 GTCCTGTCTGGTCCAGCCTCAGG - Intergenic
1115916581 14:38321602-38321624 CTTCTGCCCTGTGCAGCCTCAGG - Intergenic
1117384063 14:55193596-55193618 CTACTTTTTTGTCCAGGCTAGGG - Intergenic
1118894376 14:69933559-69933581 CTTCTCTGTTGCCCAGGCTGGGG + Intronic
1119933784 14:78571999-78572021 CTTCTGTCTTCTCCATTCTTTGG + Intronic
1120464374 14:84837909-84837931 CATCTGTATTCTGCAGGCTCTGG - Intergenic
1121936092 14:98020311-98020333 CTTCTGTCAGGTCCAGGGTCTGG + Intergenic
1122061434 14:99139127-99139149 CTCCTGTCATGGCCAGGCTGTGG + Intergenic
1122672294 14:103382120-103382142 TTGCTCTCTTGTCCAGGCTGGGG - Intergenic
1202887692 14_KI270722v1_random:123272-123294 GTTATGTCTTATCCAGGCTTTGG + Intergenic
1127311316 15:57754448-57754470 CTGCTGGTTTTTCCAGGCTCTGG + Intronic
1127353604 15:58176484-58176506 CTTCTTTTTTGCCCAGGCTGAGG - Intronic
1127816201 15:62611321-62611343 CTGCTGTTTTCTCTAGGCTCAGG + Intronic
1127961578 15:63894545-63894567 CCTCTGCTGTGTCCAGGCTCTGG - Intergenic
1129017547 15:72481866-72481888 TTTCTCTCTTGCCCAGGCTGGGG + Intronic
1129170072 15:73802157-73802179 CTTCTCTCTTGACCTGACTCCGG - Intergenic
1130332376 15:82932467-82932489 TTGCTGTGTTGCCCAGGCTCAGG - Intronic
1130769047 15:86905979-86906001 CTTCTGTGCTCTCCAGGCTGCGG - Intronic
1133427485 16:5705291-5705313 TTGCTGTCTTGTCCAGGCTAGGG + Intergenic
1134382154 16:13737888-13737910 CTTCTGTCTATCCCAGGATCTGG + Intergenic
1136269607 16:29140902-29140924 CTTCTGTCCTGTTCCTGCTCAGG - Intergenic
1137736424 16:50727106-50727128 TTTCTCTCTTGTCCAGTCTAGGG - Intronic
1138093900 16:54197173-54197195 CTCCTGTCCTGCCCAGGGTCAGG - Intergenic
1138392120 16:56677443-56677465 CTTCTGCTCTGTCCTGGCTCTGG + Intronic
1138498740 16:57425311-57425333 CTTCTCTCCTGTCCACACTCTGG + Intergenic
1138680138 16:58678301-58678323 CTTCTGTCTGACCCAGGCTGGGG + Intronic
1139153486 16:64413048-64413070 TCTCTGTCTTATTCAGGCTCTGG + Intergenic
1139214602 16:65114861-65114883 TTTCTGTCTTTTGCAGGCCCAGG - Intronic
1139323415 16:66133611-66133633 CTCCTGTCTTGTTGAGGCTGAGG - Intergenic
1141329340 16:83094465-83094487 CTTCTGTGTTGTCCTTACTCAGG + Intronic
1141329376 16:83094783-83094805 CTTCTGACTTGTCAAGGCGTGGG + Intronic
1142191814 16:88721600-88721622 CGTCAGTCTTCTCCAGGCCCAGG + Exonic
1144615632 17:16768906-16768928 CATCTTTCTTGTTCAGGCTGTGG + Intronic
1144897072 17:18546761-18546783 CATCTTTCTTGTTCAGGCTGTGG - Intergenic
1145929087 17:28671632-28671654 CTACTGTCGTTTCCAGGCTTTGG + Intronic
1146113120 17:30110018-30110040 CTTTTGGCTTGTCATGGCTCAGG + Intergenic
1146281458 17:31547771-31547793 GTGCTGTGTTGTCCAGGCTAGGG + Intergenic
1147542561 17:41372862-41372884 CTTCTCCAATGTCCAGGCTCTGG + Intronic
1147561411 17:41511574-41511596 CTTCTCTCTGGGCCAGACTCTGG - Intergenic
1147776884 17:42908226-42908248 CTGCTATGTTGCCCAGGCTCAGG + Intronic
1148117154 17:45182906-45182928 CTTCTGTCCTATCCAGGCGAGGG + Intergenic
1152206489 17:78977208-78977230 CTTCTGTCTGCTGCAGGATCTGG - Exonic
1152780831 17:82226816-82226838 GTCCTGTTCTGTCCAGGCTCCGG + Intergenic
1153340360 18:3967044-3967066 CTACTCTCTTCTCCAGGTTCTGG - Intronic
1153418973 18:4882985-4883007 CTTCTGTCTCTGCCAGGCTTTGG + Intergenic
1153988362 18:10373221-10373243 CTTCTTTCCTCTCCAGGCTCTGG - Intergenic
1155567144 18:27147682-27147704 CCTCTATCTTTTCCAGGTTCTGG + Intronic
1156296830 18:35799863-35799885 CTTCTGTCTTCTCCTGCCTTAGG + Intergenic
1156298654 18:35816645-35816667 CTTGAGTCTGGTCCAGTCTCTGG + Intergenic
1157666087 18:49488147-49488169 GTTCTGTCTTGCCCACGCTGGGG + Intronic
1162123040 19:8484119-8484141 CTTCTGTGTTGGGCTGGCTCTGG + Intronic
1162361140 19:10221263-10221285 CCTCTGTTTTCTCCTGGCTCAGG + Intronic
1162618428 19:11820529-11820551 CTCCTGTCTTTTCCAGGTTTCGG + Intronic
1163842233 19:19618515-19618537 CCTGTGCCTCGTCCAGGCTCTGG + Exonic
1164489384 19:28692701-28692723 CCTGTGGCTTTTCCAGGCTCAGG - Intergenic
1166721860 19:45001583-45001605 CTTCGGTCTGGGCCAGCCTCTGG + Exonic
1167732796 19:51271147-51271169 CTTCTGACTAGCTCAGGCTCTGG + Intergenic
1168233460 19:55047482-55047504 TTTCTTTCTTCCCCAGGCTCTGG - Exonic
1202663097 1_KI270708v1_random:90114-90136 GTTATGTCTTATCCAGGCTTTGG + Intergenic
925357194 2:3250169-3250191 CTTTTGGTTTTTCCAGGCTCAGG - Intronic
926765778 2:16321787-16321809 CTCCTGTTCTGTCCAGGCCCAGG + Intergenic
927144596 2:20154429-20154451 CTGCTCTGTTGTCCAGGCTGGGG - Intergenic
927867308 2:26598443-26598465 CTTCTCTCTTCTGCAGCCTCTGG - Intronic
928099274 2:28426027-28426049 CATCTGTCTAATCCAGGCTAGGG - Intergenic
929893325 2:45936975-45936997 CTTGTGTCTGTACCAGGCTCTGG - Intronic
930263866 2:49177248-49177270 CTTCTGGCATGTCCAGGCCAAGG + Intergenic
930952120 2:57155878-57155900 CTTGTGGCTTTCCCAGGCTCAGG + Intergenic
930968934 2:57370249-57370271 TTGCTGTATTGTCCAGGCTGGGG + Intergenic
931048005 2:58379036-58379058 CTTCTGTCTTGTACTTGCACTGG - Intergenic
932947980 2:76259791-76259813 GTTCTGACTGGTACAGGCTCGGG - Intergenic
934554391 2:95279671-95279693 CTTGTGTGGTCTCCAGGCTCAGG - Intronic
935361503 2:102250325-102250347 CTTCTGCCTTCTCCAGGCAACGG + Intergenic
935379355 2:102435282-102435304 TTTCTGTCCTGTCCTGGATCAGG - Intronic
937176167 2:119937909-119937931 TTGCTGTATTGTCCAGGCTGAGG - Intronic
937323557 2:120975178-120975200 CTTCTGTCTAGTAGAGGCCCTGG - Intronic
939045096 2:137240538-137240560 TTGCTTTATTGTCCAGGCTCTGG + Intronic
941753945 2:169164541-169164563 TGTCTGTCATTTCCAGGCTCAGG + Intronic
944012534 2:194990726-194990748 GTTCTATTTTGTCCAGGCCCAGG - Intergenic
947228434 2:227861989-227862011 CTTTTGTCTGGCCTAGGCTCTGG + Intergenic
948714517 2:239852083-239852105 GTTCTGTCTGGGCTAGGCTCTGG + Intergenic
1168835155 20:872925-872947 CTCCTGTGTGGTCCAGCCTCTGG + Exonic
1170570938 20:17632254-17632276 CTCCTGTCCTCTCCAGACTCAGG - Intronic
1170719134 20:18859875-18859897 CCTGTGTCTTTTCCAGGCACCGG - Intergenic
1170911867 20:20580235-20580257 TTTCTGTCTTCTCAATGCTCTGG + Intronic
1171570968 20:26251439-26251461 CTCCTGCTTTGTCAAGGCTCAGG + Intergenic
1172100373 20:32481675-32481697 CTCCTGTCTAATCCAGGCTCAGG - Intronic
1172167987 20:32910495-32910517 CTCTTGTCTGGCCCAGGCTCTGG + Intronic
1172319235 20:33983319-33983341 CTTCTGTCTTGTCCAGTGAGTGG + Intergenic
1172555137 20:35834191-35834213 CTTCTGTCTAGTCCTGGTTATGG + Intronic
1173247747 20:41347994-41348016 CATCTGGCTTGTCCTGGGTCTGG + Intronic
1173399292 20:42710376-42710398 CTTCTGCCCTGCCCAGCCTCAGG + Intronic
1173423497 20:42923630-42923652 CATCTGCCCTGTTCAGGCTCTGG - Intronic
1178010454 21:28279622-28279644 CTTCTATCTTTCCCAGCCTCTGG - Intergenic
1178673137 21:34609651-34609673 CTTCAGGCTTTTCCAGCCTCAGG - Intronic
1179180248 21:39038334-39038356 CTTCTGTCTTGGCTGGGCTGTGG + Intergenic
1179360784 21:40706253-40706275 CTTCTGACTTGCCCAGGATCAGG + Intronic
1180246057 21:46548105-46548127 CTTCTCTGTTGTCCATCCTCTGG - Intronic
1180329837 22:11466999-11467021 GTTATGTCTTATCCAGGCTTTGG + Intergenic
1180573139 22:16748452-16748474 CTCCTGCTTTGTCAAGGCTCAGG + Intergenic
1180785061 22:18542528-18542550 CTTCTGCCTGCTCCAGGCTGTGG + Intergenic
1181241964 22:21481882-21481904 CTTCTGCCTGCTCCAGGCTGTGG + Intergenic
1181583912 22:23842563-23842585 ATTCTTTCTTGTCCAGTCTGAGG + Intergenic
1183280139 22:36927644-36927666 CTTCTGTCTCCTGCAGTCTCAGG + Intronic
1183321061 22:37165457-37165479 CGTCTGTATTATCCTGGCTCAGG + Intronic
1183391088 22:37546065-37546087 GCTCTGGCTTGACCAGGCTCTGG - Intergenic
1183489780 22:38110254-38110276 CTCCTGCCTTGTCCAGCATCTGG + Intronic
1184967262 22:47988637-47988659 CTGCTCTTCTGTCCAGGCTCTGG + Intergenic
1185035795 22:48476184-48476206 CATCTGTCTTTTCCAGACTGTGG - Intergenic
949847803 3:8389463-8389485 CTTCTCTCTTCTCCTGGCCCTGG - Intergenic
950406469 3:12808194-12808216 CTTGTGCCCTGTGCAGGCTCCGG + Exonic
950791832 3:15478142-15478164 CTGCTGTGGTGTCCATGCTCAGG - Intronic
951035823 3:17930755-17930777 CTTCTGTCTTCTTCAGTCCCAGG - Intronic
954985828 3:54790824-54790846 TTTCTTTCTTGGCCATGCTCAGG + Intronic
955380939 3:58437433-58437455 CTCCTGGCTCGTCCTGGCTCAGG - Intergenic
955469962 3:59276321-59276343 CTTCTGTCTTCTCCAGGTTTTGG - Intergenic
957092747 3:75748361-75748383 ATTATGTCTCGTCCAGGCTTTGG - Intronic
957903837 3:86533155-86533177 CCTTTGGCTTTTCCAGGCTCAGG + Intergenic
958630684 3:96679248-96679270 CTACTGTCCTTCCCAGGCTCTGG + Intergenic
959252825 3:103970592-103970614 CCCCTGTCTTTTCCAGGTTCTGG + Intergenic
959902158 3:111673617-111673639 CTTCAGTCTTGTCTTAGCTCAGG + Intergenic
961197085 3:125011811-125011833 CTTCTGGCTTGTCCAGACATGGG - Intronic
961685224 3:128625320-128625342 CTTCTGTCTTGCTTTGGCTCTGG - Intronic
962090076 3:132234007-132234029 CATCAGTCTTTTCCAGCCTCTGG + Intronic
962178785 3:133183532-133183554 CTTCTGTCCTGGCCAGGGTAAGG + Intronic
962233249 3:133684876-133684898 GTTGTGTCTTTTCCAGGCTTTGG - Intergenic
964079807 3:152740638-152740660 CTTCTGTCTTCTGCAGCATCTGG - Intergenic
965237119 3:166138445-166138467 GCTCTGTCATGCCCAGGCTCTGG + Intergenic
966883778 3:184363405-184363427 CTCCGGTCTTGTCCACGCTAGGG + Intronic
968683736 4:1941143-1941165 TTTCTTTCTTGTCCAAGTTCAGG + Intronic
969346503 4:6573850-6573872 CTTCTGTCCTGTCCACCCCCTGG - Intergenic
970419860 4:15895713-15895735 CATCTGTTAAGTCCAGGCTCTGG - Intergenic
970992922 4:22234302-22234324 CTTATTACTTGTCCAGGGTCTGG - Intergenic
975477958 4:74844483-74844505 CTGCTCTCTTGCCCAGGCTGGGG + Intergenic
975645227 4:76539302-76539324 CTTCTATCATGTCCAGGGTCTGG + Intronic
977271008 4:94917326-94917348 CCTCTGGCTTTTCCAGGCACAGG - Intronic
977497595 4:97797657-97797679 GTTGTGTCTTTTCCAGGCTTTGG + Intronic
977683404 4:99819823-99819845 CCTCTGTTTTTTTCAGGCTCTGG + Intronic
982506069 4:156219139-156219161 CCTATGGCTTTTCCAGGCTCAGG - Intergenic
983351611 4:166597464-166597486 TTTCTGTCTTGTTCCTGCTCTGG + Intergenic
983655904 4:170084220-170084242 CTCCTGTCCTTTCCAGCCTCTGG - Intronic
984018444 4:174454727-174454749 CCTCTCTGTTGTCCAGGCTGCGG + Intergenic
985477550 5:86932-86954 TTTCTCTCTTGCCCAGGCTGTGG + Intergenic
985596643 5:794690-794712 CTTGTGGCTTTTCCAGGCTGAGG - Intergenic
986009013 5:3695292-3695314 CATCTGGCCTGCCCAGGCTCTGG + Intergenic
986789727 5:11148155-11148177 ATTCTGCCTTGCCCAGGCCCTGG - Intronic
989161864 5:38399090-38399112 CTTCTGTCCAGTCCAGACTATGG + Intronic
989733970 5:44680246-44680268 CTTGTGTCTCTTCCAGGTTCTGG - Intergenic
990587859 5:57229558-57229580 ACTCTGTCTCGTCCAGGCTCTGG + Intronic
991059373 5:62356815-62356837 CTTCTCTGTTGCCCAGGCTGAGG + Intronic
993110907 5:83656294-83656316 TTTCTGTGTTGCCCAGGCTGGGG - Intronic
995113009 5:108448097-108448119 TTGCTGTGTTGTCCAGGCACTGG + Intergenic
995578736 5:113571681-113571703 CTTCTTTCTGGTTCAGTCTCAGG + Intronic
998168973 5:139860940-139860962 CTTCTGAATTGTCCAGACTGAGG + Intronic
1001107908 5:168871123-168871145 TTCCTGTCTTTTCCAGGATCGGG + Intronic
1001193587 5:169652348-169652370 GTTCTGTCTTTTCCTGGCTCTGG - Intronic
1001288945 5:170442984-170443006 CTTCTGTCTAGACCAGGCTCTGG - Intronic
1002002983 5:176208580-176208602 CTGCTGTCCTGTGCAGCCTCAGG - Intergenic
1002223529 5:177702675-177702697 CTGCTGTCCTGTGCAGCCTCGGG + Intergenic
1004756737 6:18618379-18618401 CTGCTGCCTTGTGCAGCCTCAGG - Intergenic
1005684550 6:28240508-28240530 CTTATGTCATGTCTATGCTCAGG - Intergenic
1006507012 6:34495875-34495897 CCTCTGTCTCGCCCAGGCCCAGG + Intronic
1006521788 6:34575108-34575130 CTCCTCTCTTCTCCAGGCTTGGG + Intergenic
1007426810 6:41752022-41752044 CCTCTTTCTGGTCCAGGATCTGG + Intronic
1007464796 6:42044192-42044214 CTTCTGTCTTGTCCAGGCTCCGG - Intronic
1007978192 6:46123103-46123125 CTTGTGTCTCTTCCAGGCTTTGG - Intergenic
1008622289 6:53282394-53282416 CTTCTGGCTTGTCCAGAGCCAGG - Intronic
1009872182 6:69466936-69466958 TTCCTGTCATGTCCAGGCACTGG + Intergenic
1009897337 6:69769259-69769281 CTTCTGTCATGTCAAACCTCTGG + Intronic
1010463493 6:76140255-76140277 GTTGTGTCTTTTCCAGGCTTTGG + Intergenic
1011536916 6:88385697-88385719 TCTCTGTCTTGCACAGGCTCTGG - Intergenic
1013271917 6:108553314-108553336 CCTCAGTCTTGTCCAAGATCAGG - Intergenic
1014311720 6:119812098-119812120 CTCCTGTCTTCTCCAGTCACAGG + Intergenic
1014578583 6:123106119-123106141 ATTGTGTCTTTTCCAGGTTCTGG + Intergenic
1017901721 6:158723797-158723819 CTTCTGGCTTTTCCAGCCTCTGG + Intronic
1020668195 7:11073553-11073575 CCTGTGGCTTTTCCAGGCTCAGG + Intronic
1024383161 7:48722666-48722688 CTTGTGACTTTTCCAGGCACGGG + Intergenic
1025285278 7:57655483-57655505 CTCCTGCTTTGTCAAGGCTCAGG + Intergenic
1025852352 7:65253830-65253852 TTGCAGTGTTGTCCAGGCTCTGG + Intergenic
1028070970 7:86450137-86450159 CATCTGTCTTATTCAGGCCCTGG + Intergenic
1029668987 7:102015781-102015803 CTTCTCTCCTGTCTAGGGTCAGG + Intronic
1029900690 7:104036267-104036289 CTGCTCTCTTCTCCAGGCTGGGG + Intergenic
1030139618 7:106291505-106291527 TTTCTTTCTTCTCCTGGCTCAGG + Intergenic
1031389952 7:121201841-121201863 CTTCTTTCGTGTTCAGGCTAAGG - Intronic
1031807590 7:126327096-126327118 CTTCTGCTTTGTGCAGCCTCAGG + Intergenic
1033356183 7:140602012-140602034 CTTAGGTCTTGCCCCGGCTCTGG + Exonic
1033430677 7:141286711-141286733 CTTCTTTCTAGTGCTGGCTCAGG - Intronic
1033542226 7:142367638-142367660 GTTTTGGCTTGTCCAGGCACAGG + Intergenic
1033562503 7:142545887-142545909 CTTATGCCTTTTCCAGGCTGTGG - Intergenic
1035169184 7:157008531-157008553 CTTGTGACTTCTCCAGCCTCTGG + Intronic
1038708769 8:29921522-29921544 CTTCTGTCATCTCCAGGCAATGG - Intergenic
1038713104 8:29966966-29966988 TTTCTGTGTTGTGCAGGCTGGGG - Intergenic
1039078814 8:33716048-33716070 TTTGTGGCTTGTCCAGGCTGGGG - Intergenic
1039335992 8:36590010-36590032 AATCTGAGTTGTCCAGGCTCAGG - Intergenic
1039863424 8:41479363-41479385 CCTCTGCCTGGTCCAGGCTCAGG + Intergenic
1041491537 8:58438370-58438392 CCTGTGGCTTTTCCAGGCTCAGG - Intronic
1043594266 8:81865538-81865560 CTTCTGGCTTGTACAGTTTCTGG - Intergenic
1044107395 8:88227547-88227569 CTTTCCTCTTGTCAAGGCTCAGG + Intronic
1044152655 8:88800706-88800728 CTGCTGTCCTGTGCAGCCTCAGG + Intergenic
1045472210 8:102522563-102522585 CTGCCTTCTTTTCCAGGCTCAGG + Intergenic
1046517007 8:115275693-115275715 CTTCTGTCCTCTGCAGGCTCAGG - Intergenic
1047688290 8:127323423-127323445 CCTGTGGCTTTTCCAGGCTCAGG - Intergenic
1048302836 8:133264381-133264403 TTTCTGGCTTTTCCAGGCTGTGG + Intronic
1048538324 8:135318375-135318397 TTACTATCATGTCCAGGCTCTGG - Intergenic
1049538139 8:143192085-143192107 ATGCTATCTTGCCCAGGCTCAGG - Intergenic
1050210588 9:3251377-3251399 TTGCTGTATTGTCCAGGCTGGGG + Intronic
1050728188 9:8676412-8676434 TTGCTGTGTTGTCCAGGCTGTGG + Intronic
1055790029 9:79913836-79913858 CTTCTGTTTTGTCCAGTGTGTGG - Intergenic
1056234355 9:84577139-84577161 GCTCTGTCTTGCCCAGGCTGGGG - Intergenic
1056372377 9:85969662-85969684 TTGCTGTGTTGTCCAGGCTGTGG - Intronic
1056451113 9:86717623-86717645 CTTGTGTCTTGTTCAGACTTAGG + Intergenic
1056707244 9:88961648-88961670 CTCCTGTCTTTACCAGGCTCAGG - Intergenic
1057437006 9:95049966-95049988 CTTCAGGCTGCTCCAGGCTCTGG + Intronic
1059489986 9:114658975-114658997 CCTTTCTCTTTTCCAGGCTCTGG + Intergenic
1059494637 9:114699495-114699517 GGTCTGTCATGTCCCGGCTCCGG - Intergenic
1060297221 9:122350945-122350967 CTTCTGTCTTTCCCAGTCTAAGG + Intergenic
1060348755 9:122839076-122839098 CCTGTGACTTTTCCAGGCTCAGG + Intergenic
1060969446 9:127729973-127729995 CTTCTGTCTCCTCCAGGCTAGGG - Intronic
1061137393 9:128742745-128742767 CTTGTGTCCTGTCCCGGCCCAGG - Exonic
1061849146 9:133404474-133404496 CTAGTGTCTTGGCCAGGCCCAGG - Intronic
1062345148 9:136111037-136111059 CTTCTCTGTGGTCCAGGCTCAGG + Intergenic
1062591730 9:137277530-137277552 CTCCTGGCTTGGTCAGGCTCAGG - Intergenic
1203737952 Un_GL000216v2:154739-154761 CTTAACTCTTGTCTAGGCTCTGG - Intergenic
1185757192 X:2661332-2661354 CTGCTGTCATCTCCAGGGTCTGG - Intergenic
1185981436 X:4784435-4784457 TTGCTGTGTTGTCCAGGCTGGGG + Intergenic
1186413281 X:9362069-9362091 TTGCTGTGTTGTCCAGGCTGGGG - Intergenic
1188016340 X:25111861-25111883 CTTGTGGCTTTTCTAGGCTCAGG + Intergenic
1190939627 X:55027857-55027879 CTTCTGTCTTTTCCAATTTCAGG - Intronic
1191073409 X:56426529-56426551 GTTTTGTCTTTTCCAGGCTTTGG + Intergenic
1192923221 X:75729562-75729584 ATTCTTTCATGGCCAGGCTCAGG - Intergenic
1193224897 X:78971172-78971194 CCTCTCTCTTGTCCCTGCTCTGG - Intergenic
1193563823 X:83053301-83053323 CTTCTTTCTTGTTCAGTCTTGGG + Intergenic
1194306763 X:92257826-92257848 CTTGTGGCTTTTCCAGGCACAGG + Intronic
1194808875 X:98365227-98365249 CTTCTGTTTGGTCCATGCTTAGG + Intergenic
1195289727 X:103420554-103420576 CCTGTGACTTCTCCAGGCTCAGG + Intergenic
1196066609 X:111471197-111471219 CTTGTGGCTTTTCCAGGCTCAGG + Intergenic
1198482920 X:137057249-137057271 CTTGTGTCTTGTGGAGTCTCTGG - Intergenic
1199668146 X:150118581-150118603 CTTCTGCCTTGTCCAGGACATGG - Intergenic
1199768410 X:150957621-150957643 CTGCTGTGTTGCCCAGGCTGGGG - Intergenic
1200391755 X:155952632-155952654 GTTCTGTCTTGTTTAGGCTTGGG + Intergenic
1202092107 Y:21202892-21202914 CTCCTATCATTTCCAGGCTCTGG + Intergenic