ID: 1007464798

View in Genome Browser
Species Human (GRCh38)
Location 6:42044206-42044228
Sequence AGACAGAAGAGCACCTTTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464796_1007464798 -9 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464798 6:42044206-42044228 AGACAGAAGAGCACCTTTTACGG 0: 1
1: 1
2: 0
3: 21
4: 199
1007464791_1007464798 20 Left 1007464791 6:42044163-42044185 CCGCAGAGGCGGAGGCCTGCACG 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1007464798 6:42044206-42044228 AGACAGAAGAGCACCTTTTACGG 0: 1
1: 1
2: 0
3: 21
4: 199
1007464794_1007464798 5 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464798 6:42044206-42044228 AGACAGAAGAGCACCTTTTACGG 0: 1
1: 1
2: 0
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464798 Original CRISPR AGACAGAAGAGCACCTTTTA CGG Intronic
900325130 1:2104874-2104896 AGAGAGAAGAGCAGTTTTCAGGG + Intronic
901451180 1:9337873-9337895 AGACCCAAGAGCACCTTTAGGGG + Intronic
901735745 1:11311088-11311110 GGAGAGAAGAGCACCCTTGATGG - Intergenic
903432136 1:23313552-23313574 AGACAGAGGAGCAGCTGTTAAGG - Exonic
904907926 1:33912088-33912110 AGAAAGGAGAGCACCTTCCAGGG - Intronic
905930210 1:41781598-41781620 AGGCAGAAGAGCTCCTTCTGTGG - Intronic
907070769 1:51532726-51532748 AGAGAGAAGAGGACCTATCAAGG + Intergenic
907217792 1:52880669-52880691 AGGGAGAAGCCCACCTTTTAAGG + Intronic
908022352 1:59911239-59911261 ATACAGAAGAGAACCTCTGAGGG + Intronic
909161356 1:72154215-72154237 ACACAGAAGTGAACATTTTAAGG + Intronic
909359790 1:74746843-74746865 AAAAAGAAGAGGACCTTTTTAGG + Intronic
910135242 1:83960552-83960574 AGACAGAAGAGCCAGTTTGAGGG + Intronic
911173883 1:94799248-94799270 AGAAAGCAGAAAACCTTTTACGG - Intergenic
911340487 1:96630650-96630672 AGACACAAGAGAACCTTCTGAGG + Intergenic
911672599 1:100623663-100623685 ACAGAGAAAAGCAACTTTTATGG + Intergenic
913080303 1:115378573-115378595 AGACAGAAGAGAAGGTTTTGTGG - Intergenic
913558219 1:119991223-119991245 ACACAGAAGAGCAACTTTCAGGG + Intronic
913639623 1:120799229-120799251 ACACAGAAGAGCAACTTTCAGGG - Intergenic
914278825 1:146150714-146150736 ACACAGAAGAGCAACTTTCAGGG + Intronic
914412083 1:147439255-147439277 ATAAAGATGAACACCTTTTATGG + Intergenic
914539872 1:148601656-148601678 ACACAGAAGAGCAACTTTCAGGG + Intronic
914626774 1:149469564-149469586 ACACAGAAGAGCAACTTTCAGGG - Intergenic
915955233 1:160215295-160215317 AGACAGAAGAGCACAAGATAGGG - Exonic
916380483 1:164205244-164205266 TGACAGAAGACCACCTTTCAGGG + Intergenic
916434349 1:164763269-164763291 TGACACAGGATCACCTTTTAGGG - Intronic
916557477 1:165905795-165905817 GCCCAGAAGAGCACCTTTTAAGG - Intronic
917179433 1:172279287-172279309 AGACATAAGAGACCCTTTTTGGG - Intronic
918564675 1:185914729-185914751 AGAGAGAAAAGAACATTTTAGGG - Intronic
919337641 1:196259078-196259100 AGTCAGAAAAGCACTTTATATGG - Intronic
920657347 1:207886811-207886833 AGACAGAAAAGCATCTGTTGGGG + Exonic
920666433 1:207965988-207966010 CCACAGAAGAGCATCTTGTAAGG - Intergenic
924841473 1:247714157-247714179 TGCCAGAGGAGCACATTTTATGG - Intergenic
1063638583 10:7809489-7809511 ACACAGAAGAGCACCACTAAAGG - Intergenic
1064173212 10:13052012-13052034 AGATAGGAGGGCCCCTTTTATGG + Intronic
1065034654 10:21625299-21625321 AGACAGACGAGCAGCTGTTATGG - Intronic
1068800310 10:61132922-61132944 AGACAGAAGAGGCCCATTTGAGG + Intergenic
1070396254 10:76013484-76013506 ACACAGAAGAGCGCTCTTTAAGG + Intronic
1070645732 10:78200979-78201001 AGGAAGATGAGGACCTTTTAAGG - Intergenic
1071951971 10:90713495-90713517 ATTCAGAAGAGCTCCTTTTGAGG - Intergenic
1072004331 10:91228829-91228851 AGATAGAAGTGCACATTTTGGGG + Intronic
1073927933 10:108538708-108538730 ACCCAGAAGAGCACATTTTTGGG + Intergenic
1075111168 10:119585885-119585907 AGACAGAAGAGAATGTTTAAAGG - Intronic
1075812877 10:125238860-125238882 AGCCAGCAGGGCACCTTTAAAGG + Intergenic
1078416180 11:11168058-11168080 AGGCAGCAGAGAATCTTTTATGG - Intergenic
1080176844 11:29373675-29373697 AGAAACAAGAGCACCTGTAAAGG - Intergenic
1080216551 11:29849027-29849049 AGACATAGGAGTTCCTTTTATGG - Intergenic
1084661557 11:70549414-70549436 ATACAGAGGAGCACCTTTCTCGG - Intronic
1085014273 11:73162677-73162699 AGACAAAACAGGACCTTTTGTGG + Intergenic
1085178135 11:74508492-74508514 AGAGAGAAGAGCCCATGTTAAGG + Intronic
1085599341 11:77840854-77840876 AAACAGAAGAACAACTTTCAGGG - Intronic
1085742815 11:79091533-79091555 AGGCAGTAGAGAACCATTTAAGG - Intronic
1086127590 11:83365239-83365261 AGAGAGTCTAGCACCTTTTAAGG - Intergenic
1088354341 11:108926676-108926698 AGAAAGCTGAGCACATTTTATGG + Intronic
1088366335 11:109043992-109044014 AGACAGGAGAGCTTCTTTTAGGG + Intergenic
1088651218 11:111959245-111959267 AGAGAGAAGAGCTCCCTTTGGGG + Intronic
1088920529 11:114257310-114257332 AGACAGAGAAGCAACTTCTAGGG - Intergenic
1090523710 11:127506173-127506195 AGACAGAGGTTGACCTTTTAGGG - Intergenic
1092784469 12:12015064-12015086 AGAAAGAAGAGCACTTTTTGAGG + Intergenic
1094593544 12:31843581-31843603 AGAGATAAGAGCCTCTTTTAAGG - Intergenic
1094629685 12:32160656-32160678 AGACAGAAAAGCAATTTTAAGGG - Intronic
1096303662 12:50454950-50454972 AGACATAAGTGCACCTATAAAGG - Intronic
1097785638 12:63755841-63755863 AGAGAGAAAAGCACTTTCTAGGG - Intergenic
1097969444 12:65616832-65616854 AGACAGGAGGGCAGCTTTCAAGG - Intergenic
1099690634 12:85947366-85947388 AGACAGAAGCCCACCTGCTACGG + Intergenic
1101650163 12:106670174-106670196 AGAAAGAAGAGCACCTAGAAAGG - Intronic
1104294058 12:127495719-127495741 AGCCAGAAGGGCAGCTTGTAGGG + Intergenic
1104398902 12:128459564-128459586 AGACAGAAGACCAAGTTTTGAGG + Intronic
1104547921 12:129729106-129729128 CAACAGAATAGCACCCTTTAGGG + Intronic
1106183316 13:27386666-27386688 AGCCAGGGGAGCACCTCTTAGGG + Intergenic
1106999148 13:35523375-35523397 AGAAAGAAGAACAGATTTTAAGG + Intronic
1110580065 13:77111316-77111338 AAACACAAAACCACCTTTTAAGG - Intronic
1112108608 13:96269510-96269532 AGGCAGAAGTGCACGTTTCATGG - Intronic
1113198589 13:107838495-107838517 AGACTGGAGATCACATTTTAAGG + Intronic
1116355900 14:43929453-43929475 AGAAAAAAGAGTACCTTTGAAGG + Intergenic
1116622968 14:47229215-47229237 AGAAAGATAAGCTCCTTTTAAGG - Intronic
1118610931 14:67539218-67539240 AGACAAAACAGAACCTTGTAAGG - Intronic
1119469170 14:74882966-74882988 GGACAGAAGAGCCCTTTTTGAGG + Intronic
1120732662 14:88020958-88020980 AGGGAGGAGATCACCTTTTAGGG + Intergenic
1121901562 14:97697747-97697769 AGACTGAAGAGGACCTTTGGGGG - Intergenic
1122482705 14:102057778-102057800 AGACAGAGGGGCACGTTTTGTGG - Intergenic
1122659161 14:103282871-103282893 AGACAGACGTGCACATTTTTGGG + Intergenic
1124020061 15:25912557-25912579 AGACAGATGAGCACCTTCATTGG + Intergenic
1125253831 15:37739355-37739377 AGAGAGAAAAGCACCTTGTCAGG + Intergenic
1127563424 15:60163119-60163141 AGGCAGCAGATCAGCTTTTAGGG + Intergenic
1127700264 15:61492731-61492753 AGAAAAAATAGCAACTTTTAAGG - Intergenic
1129040511 15:72682323-72682345 TGAGAGAAGAGCATCTTTTCTGG - Intronic
1131216800 15:90543829-90543851 AGACACAAGGGAACCTTTTGGGG - Intronic
1131636918 15:94245742-94245764 AGACAAAAGAGTACCTTTGAAGG + Intronic
1133860645 16:9591766-9591788 AGACAGAAAAGCTCCTTGGAGGG + Intergenic
1134463534 16:14451311-14451333 AGACAGAAAAGCAGAGTTTATGG - Intronic
1135201933 16:20445020-20445042 AGACAGAAGAGCAGGTTCAAAGG + Intergenic
1135217171 16:20582846-20582868 AGACAGAAGAGCAGGTTCAAAGG - Intergenic
1136034985 16:27532363-27532385 AGACAGAAGACCACTCATTAGGG + Intronic
1138836235 16:60439046-60439068 AGATAGAAGAAAACATTTTAGGG - Intergenic
1140127159 16:72127356-72127378 AAACAGAAGTGCATCTTTTCTGG + Intronic
1145121020 17:20260163-20260185 AGAAAGAAGAGCACATGGTAAGG - Intronic
1145173636 17:20681666-20681688 AGAGAGAAGAGCACATGTTAAGG - Intergenic
1145810165 17:27759651-27759673 GGACAGAAGAGCCCCTCTGATGG + Intronic
1145989617 17:29071106-29071128 AGACAAAAGAAGACCATTTAGGG + Intergenic
1146123647 17:30215816-30215838 AGGCAGAAAAACAGCTTTTAAGG + Intronic
1147026285 17:37587404-37587426 GGACAGAAGAGGAACTTTTCAGG - Intronic
1148418304 17:47525268-47525290 AGAAAGAAGAGAACCTTACATGG - Intronic
1148956340 17:51356856-51356878 GAAAAGAAGAGAACCTTTTAGGG - Intergenic
1149404496 17:56333849-56333871 AGCTAGGAGACCACCTTTTATGG - Intronic
1152671803 17:81612499-81612521 TGGCAGGAGAGCACCATTTATGG + Intronic
1155460989 18:26083014-26083036 AGAAACAAGAACACCTGTTAAGG + Intronic
1156935093 18:42694859-42694881 AGAGTGAATAGCACCTTTTATGG + Intergenic
1157458769 18:47864927-47864949 AGATAGAAGATCATCTTTTTTGG + Intronic
1159318501 18:66813147-66813169 AGAAAGAAGAGCTCCTTTCAGGG + Intergenic
1164851444 19:31487606-31487628 AGAAAGATGAGAACCTTTCAGGG - Intergenic
1167659436 19:50787631-50787653 AGACACAAGACCAGCTTTGAGGG + Intergenic
928741998 2:34365836-34365858 GGAAAGAACAGCACATTTTAAGG - Intergenic
932931969 2:76051868-76051890 AGACAGAAGAGCATGTACTATGG - Intergenic
932951096 2:76294506-76294528 AGACAGCAGAGCATCTGTGAAGG + Intergenic
932967156 2:76489962-76489984 AGATAGAAGGGCATCTCTTATGG - Intergenic
935428431 2:102946111-102946133 AGACACATGATTACCTTTTATGG - Intergenic
936645639 2:114366726-114366748 AGAAAGAAAATTACCTTTTAGGG - Intergenic
937536149 2:122890134-122890156 AGACAGAACAGGAAGTTTTACGG + Intergenic
937561940 2:123236645-123236667 GGAGAGAAGAGCACTTTTTCTGG + Intergenic
938774319 2:134527977-134527999 AGACAGAATAGCACCACTTCTGG + Intronic
938882124 2:135601503-135601525 AAACAGAATAGTACATTTTAAGG - Intronic
939473802 2:142659434-142659456 AGGCAGAAGAGCAGAATTTAAGG - Intergenic
939970730 2:148656804-148656826 ACACAGATGAACACATTTTAAGG + Intronic
940903260 2:159146283-159146305 AGACTGAAGGGGACCTTTTAAGG + Intronic
940976930 2:159956789-159956811 ACAAAGAGGAGCAGCTTTTAGGG + Intronic
943033298 2:182711343-182711365 AGACAGAAGAGCTACATTTATGG + Intergenic
943092555 2:183391888-183391910 AGCCACAAGAACACCTTTAAGGG + Intergenic
944484459 2:200190272-200190294 AGACTGAAGTGCAGTTTTTATGG - Intergenic
948118373 2:235510851-235510873 AGACTGAAGACCACCTTAGAAGG + Intronic
1169936213 20:10886320-10886342 AGACAGAAAATCATCTTTTCAGG + Intergenic
1171881273 20:30618972-30618994 AGACAGATGAGAACATTTTTGGG - Intergenic
1172341904 20:34164679-34164701 AGACATAAAAGTATCTTTTAGGG - Intergenic
1173826319 20:46049991-46050013 AGGCAGAAGGGCCCATTTTATGG + Intronic
1175616112 20:60399668-60399690 ACACAGAAGAGCACAGTGTATGG - Intergenic
1177884748 21:26734163-26734185 TGACAGTAGAGCACTTATTAGGG + Intergenic
1178229671 21:30767327-30767349 AGACAAAAATTCACCTTTTATGG - Intergenic
1178283575 21:31306012-31306034 AGACAGAGGAGCACACTTGAAGG + Intronic
1182373026 22:29825522-29825544 AGACAAAAAAGCACCTCCTAGGG + Intronic
1183133808 22:35867156-35867178 ATAAAGAAAAGAACCTTTTAAGG + Intronic
1183197592 22:36364126-36364148 AAACAGAAGATCACTTTTGAAGG + Intronic
950830063 3:15864704-15864726 AGCCAGAAGAGCAGCTTATGTGG + Intergenic
952949893 3:38514514-38514536 AGTCAGAGGAGCAGCCTTTAAGG + Intronic
953208465 3:40853041-40853063 AGTCAAAAGAACTCCTTTTAAGG - Intergenic
953352821 3:42228971-42228993 AGACAGAAGAATGCCTTCTAGGG - Intergenic
953397260 3:42582823-42582845 AGGCAGCAGAGCTCCTTTGAGGG + Intronic
963768900 3:149368577-149368599 AGACAGCAGAGCTCCTCCTATGG - Intergenic
965022189 3:163245827-163245849 AAATAGAAGAGCAGCTTCTATGG - Intergenic
965597130 3:170420294-170420316 GGACAGAAGCCCACCTTGTAGGG - Intronic
967140802 3:186557643-186557665 AGACAGAATAGCTGCTTGTAAGG + Intronic
967418778 3:189250964-189250986 AGTCAGAAGAACAGATTTTAAGG - Intronic
968009888 3:195267343-195267365 AGACAGAAGTGCTCCTTAAAGGG + Intronic
969588178 4:8106648-8106670 AGAGAGAAGAGCAGCGTTCAAGG + Intronic
971672306 4:29578098-29578120 AGACAAAAGCACAGCTTTTAAGG - Intergenic
973171238 4:47146716-47146738 AGACAGAAGAGCTCACTTTCTGG + Intronic
973542202 4:51946060-51946082 AGAAAGAAAAGCCCATTTTAAGG + Intergenic
975173720 4:71262578-71262600 AGACATAAGAGAAACTTTGAAGG - Intronic
979567755 4:122175384-122175406 ACACAAAAGAGAAACTTTTAAGG - Intronic
979993420 4:127402940-127402962 AAACAAAAGAGAACCTCTTAGGG - Intergenic
989239647 5:39189207-39189229 TGGCAGAAGAACGCCTTTTATGG + Intronic
991419893 5:66430032-66430054 AGAAAGAAAAGCAGCTTTGAAGG - Intergenic
992044652 5:72873990-72874012 AGACATACCAGCACCTTATAAGG + Intronic
993519609 5:88884236-88884258 AGTCACAAGAGCAACTATTAGGG - Intronic
993562848 5:89433096-89433118 AGGCAGAAGAGCACTTCTTTTGG + Intergenic
994653162 5:102555357-102555379 AGTCAGAAGAGTTCCTTTCATGG - Intergenic
995743949 5:115384064-115384086 AGAGGGAAGAGCACCTGTGAAGG + Intergenic
996118642 5:119646825-119646847 AGTTTGAAGATCACCTTTTATGG + Intergenic
996250816 5:121329247-121329269 TGACAGAGGAGGCCCTTTTAGGG + Intergenic
996771460 5:127090887-127090909 AGACAGAGGAATAGCTTTTAAGG + Intergenic
997862751 5:137433276-137433298 AGACAGCAGAGCATCTTGTTTGG + Intronic
999047468 5:148484655-148484677 GGAAAGAAGAGAACATTTTAGGG - Intronic
999527668 5:152425384-152425406 AGATAGAAGAGTGCCTTTAAGGG + Intronic
999678994 5:154037926-154037948 AGCCAGAAGAGAATTTTTTATGG + Intronic
1001510748 5:172319831-172319853 AGAGAGATGAGCATGTTTTAAGG - Intergenic
1001663934 5:173416869-173416891 AGCCACAAGAGCACCCTTTGGGG - Intergenic
1002617243 5:180463628-180463650 AGAGAGAAGAGCAGCTTTCAGGG - Intergenic
1003635837 6:7830692-7830714 AGACAGAGGTACACCTTATATGG + Intronic
1004058927 6:12171462-12171484 AGACAAAAGAGCACATTCTGAGG + Intergenic
1004923882 6:20401606-20401628 TGGCAGAAGAGCAGTTTTTAGGG - Intergenic
1007464798 6:42044206-42044228 AGACAGAAGAGCACCTTTTACGG + Intronic
1012228984 6:96737908-96737930 ACAAAGAAGAGCAACTATTATGG + Intergenic
1018003249 6:159597941-159597963 AGTCAGAAAAATACCTTTTATGG + Intergenic
1022233401 7:28437114-28437136 ACAGAGATGAGCACCTGTTAAGG + Intronic
1022957538 7:35395296-35395318 GGATAGAACAGCACCTGTTAGGG + Intergenic
1023745989 7:43322870-43322892 AGACATAAGAACCCATTTTAAGG + Intronic
1024525637 7:50346684-50346706 ACACAGAAGAGCTCCTTTCGAGG - Intronic
1025204980 7:56987328-56987350 AGACAGGGGAGCACCTGATAGGG + Intergenic
1025666958 7:63589607-63589629 AGACAGGGGAGCACCTGATAGGG - Intergenic
1027522393 7:79225854-79225876 AGACAGGAAAACACATTTTATGG + Intronic
1028307381 7:89282736-89282758 ACACAGAAGAGCCTCTTTTCTGG + Intronic
1030188489 7:106787691-106787713 AGACAAAAGAGCACCTCTGTTGG + Intergenic
1030469034 7:109939550-109939572 AGAAAGAAAAACACCTTTTTTGG - Intergenic
1034455063 7:151165639-151165661 AGTCAGAATAGCATCTTCTAAGG - Intronic
1034761644 7:153678361-153678383 AGACAGAAGCCCATCTTTTTAGG + Intergenic
1035721677 8:1797518-1797540 AGGAAGAAGAGCACCTTGTGGGG - Intergenic
1038055736 8:23856026-23856048 AGCCAGAAGAGGACTTCTTAGGG + Intergenic
1038066776 8:23971639-23971661 AGACAGCACAGCACCTTTCATGG - Intergenic
1039140751 8:34385128-34385150 AGACTGAAGAGTACTTTTGAAGG + Intergenic
1039288625 8:36069678-36069700 AGAGAGAAGAGCATGTTGTAGGG + Intergenic
1039720068 8:40153948-40153970 TGACAGAAGAGAAGCTTGTAAGG - Exonic
1044418316 8:91961581-91961603 AGACAGAAGAGCACCTTTTGGGG + Intronic
1045205748 8:100038276-100038298 AGACAGAATAGCCTCTTTTGTGG - Intronic
1047747478 8:127855627-127855649 AGACTGGAGAGCACCTTTCCCGG + Intergenic
1048392567 8:133981661-133981683 AGATTGTAGAGCATCTTTTAAGG - Intergenic
1052747965 9:32459926-32459948 AGGCAGAAGAGCCCCTGATATGG + Intronic
1054859760 9:69937801-69937823 AGAAAGTATAGCAGCTTTTAAGG - Intergenic
1056644612 9:88400008-88400030 AGGCAGCAGAGCAGCATTTAAGG - Intronic
1060545214 9:124455248-124455270 AGACAAAAGAGAAGCTTTTCAGG - Intronic
1062586900 9:137253592-137253614 AGAGAAGAGAGCACCTTTCAGGG - Intergenic
1185815600 X:3152237-3152259 AGACAGCAGAGTACCATTCAGGG + Intergenic
1186075570 X:5874785-5874807 AGATAGAAGAGGACCTATTAGGG - Intronic
1186122376 X:6377542-6377564 AGACAGAAGAGGATGTTGTAAGG + Intergenic
1188780526 X:34278625-34278647 AGACAGATCAGAACCTTCTATGG - Intergenic
1192818164 X:74615543-74615565 GGACAGAAGAGTTCCTTGTAGGG + Intergenic
1193223647 X:78956322-78956344 AGTCAGAAGACAACATTTTAGGG + Intronic
1193640471 X:84005172-84005194 AGACAGAGGAGGAAATTTTAGGG + Intergenic
1194270163 X:91803387-91803409 AAACAGAAGAGCTCTTTTTTGGG + Intronic
1194795044 X:98200819-98200841 AAAAAGAAGAGCATATTTTATGG + Intergenic
1195397406 X:104426160-104426182 AGAGAGAAGAGCAGCTTTAGGGG - Intergenic
1196365666 X:114921028-114921050 AGAGGGAAGAGCACCTTATAAGG + Intergenic
1199306429 X:146272240-146272262 AAACTTAAGAGCACCTTTTGAGG + Intergenic
1199870765 X:151896394-151896416 AGACAGAAGGGGACATATTAAGG - Intergenic
1200587403 Y:5024826-5024848 AAACAGAAGAGCTCTTTTTTGGG + Intronic