ID: 1007464799

View in Genome Browser
Species Human (GRCh38)
Location 6:42044207-42044229
Sequence GACAGAAGAGCACCTTTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464796_1007464799 -8 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464799 6:42044207-42044229 GACAGAAGAGCACCTTTTACGGG 0: 1
1: 0
2: 1
3: 6
4: 121
1007464791_1007464799 21 Left 1007464791 6:42044163-42044185 CCGCAGAGGCGGAGGCCTGCACG 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1007464799 6:42044207-42044229 GACAGAAGAGCACCTTTTACGGG 0: 1
1: 0
2: 1
3: 6
4: 121
1007464794_1007464799 6 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464799 6:42044207-42044229 GACAGAAGAGCACCTTTTACGGG 0: 1
1: 0
2: 1
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464799 Original CRISPR GACAGAAGAGCACCTTTTAC GGG Intronic
901065237 1:6491124-6491146 GGCAGAACAGCACCCTTTTCCGG - Intronic
901372814 1:8815073-8815095 TGCAGAATAGCACCTTCTACTGG - Intronic
907729085 1:57048528-57048550 GACAGACGAGGACGTTTTTCAGG - Intronic
907919052 1:58896105-58896127 TAAAGAAGAGCATCTTTTGCTGG + Intergenic
911947967 1:104136352-104136374 GAGAGAAGAAAACCTTGTACAGG - Intergenic
913335234 1:117703618-117703640 ACCAGAAGAGCACCTTCTAAAGG - Intergenic
913986716 1:143572379-143572401 GAAAGAAGAGGACATTTTGCAGG - Intergenic
916380484 1:164205245-164205267 GACAGAAGACCACCTTTCAGGGG + Intergenic
918207470 1:182322324-182322346 CACCGAAGGGCTCCTTTTACTGG - Intergenic
920939968 1:210473024-210473046 GAGAGTTGAGCACCTTTTAAAGG - Intronic
1064589724 10:16876704-16876726 AAAAGAAGAGGACCTTTTTCAGG - Intronic
1064874207 10:19974900-19974922 GTCAGAAGATGACCTTTTCCTGG - Intronic
1065068554 10:21999360-21999382 GACTGAAGAGAACCTTGTATTGG + Intronic
1065124922 10:22565089-22565111 AGCAGAACATCACCTTTTACAGG - Intronic
1065647923 10:27855956-27855978 GACTGATGAGCACCTATTAAAGG - Intronic
1068153371 10:53163491-53163513 AAAAGAATAGCACCTTTTAGTGG + Intergenic
1071339950 10:84636631-84636653 GATAGAACAGCTCCTTCTACTGG + Intergenic
1073635600 10:105195261-105195283 GGCAGATGAGAAACTTTTACTGG + Intronic
1079428411 11:20364718-20364740 GACAGAAGAGCACTGTTTTCAGG + Intronic
1079887946 11:26012609-26012631 GACATAAAACCACCTTTTCCTGG - Intergenic
1083759459 11:64807748-64807770 GACAGAAGAGCCCCTTTTCCTGG - Intronic
1087943032 11:104123949-104123971 GAAGGAAGAGCACATTTAACAGG + Intronic
1088988420 11:114929608-114929630 GGCAGGAGAGCACCATTTCCTGG - Intergenic
1089729343 11:120511116-120511138 GAGACAAGAGCACCTTGTTCAGG - Intergenic
1090304017 11:125674608-125674630 GACACAAGAGAACCTGTTAAAGG - Intronic
1090899718 11:131017729-131017751 GACAAAAGTGCACCATTTAGTGG - Intergenic
1091723987 12:2833214-2833236 GTCAGTAGAGCACCTTCTCCTGG + Intronic
1094121893 12:26984062-26984084 GACAGAAGAGCAGAATTCACAGG + Intronic
1100581517 12:95943838-95943860 GCCAGAAGACCACCTTTGTCAGG + Intronic
1102091133 12:110189055-110189077 GACAGAAGAAGAAGTTTTACAGG - Intronic
1106309393 13:28540707-28540729 GACAGCAGAGCACCTTCGAGAGG - Intergenic
1107055623 13:36100524-36100546 GACAGAAACGAACCTTTTACTGG + Intronic
1119567897 14:75644549-75644571 GACAGGTGAGCACCATTTATTGG - Intronic
1120329204 14:83067710-83067732 GTCAAAATAGCAACTTTTACAGG - Intergenic
1121530728 14:94651486-94651508 GACAGGAGAGAACATTTCACAGG + Intergenic
1129040510 15:72682322-72682344 GAGAGAAGAGCATCTTTTCTGGG - Intronic
1133606785 16:7395245-7395267 GACAGAATTGCTCTTTTTACTGG + Intronic
1133709785 16:8390258-8390280 GAGAGAAGAGCAGGTTTTGCTGG - Intergenic
1137811245 16:51354820-51354842 GACACAAGGGCACCTTTCAAAGG - Intergenic
1139848650 16:69937588-69937610 GGCAGAAGAGCACCATCTACCGG + Exonic
1147026284 17:37587403-37587425 GACAGAAGAGGAACTTTTCAGGG - Intronic
1147849633 17:43431819-43431841 GACAGAAGAGCCCCTCCCACCGG - Intergenic
1155410294 18:25536797-25536819 CACAGAAGAACACCTTTAAGAGG - Intergenic
1156935094 18:42694860-42694882 GAGTGAATAGCACCTTTTATGGG + Intergenic
1156952980 18:42927112-42927134 GGCAGAATAGAACCTTTCACTGG + Intronic
1157504301 18:48215706-48215728 GAGAGACCAGCACCTTTTAAAGG - Intronic
1159038931 18:63304768-63304790 GATGGAAGAGCAACATTTACAGG + Intronic
1161234650 19:3191874-3191896 GACAGCAGAGCCCCTTCTCCTGG - Intronic
1165773892 19:38393966-38393988 GACAGCAGAGCATCTTTCCCGGG - Intronic
1166995617 19:46718412-46718434 GCCAGAAGAGCCCCTCTTCCTGG + Intergenic
925808178 2:7673058-7673080 GACAGAAAAGCAGCTATTAATGG + Intergenic
928420218 2:31132476-31132498 GAAAGCACAGCACCTTGTACAGG + Intronic
931352763 2:61506794-61506816 GACAGAAAAGGACCCATTACTGG + Intronic
934898337 2:98138326-98138348 GACAGGACAGTACCTTTTAATGG + Intronic
936896953 2:117438457-117438479 GACAGAAGAGTAGGTTATACAGG - Intergenic
937718623 2:125064188-125064210 GACAGAAGTTCACCTCTTGCTGG - Intergenic
939832878 2:147093846-147093868 TAAAGAAGAAAACCTTTTACAGG + Intergenic
940438337 2:153682181-153682203 GACAGAAGAGCAAAGTATACAGG - Intergenic
940903261 2:159146284-159146306 GACTGAAGGGGACCTTTTAAGGG + Intronic
941384653 2:164839484-164839506 AACAGAAGAACACTTTTTGCTGG - Intronic
944581565 2:201137126-201137148 GTCAGGAGAGCACCATTTCCTGG + Intronic
945620031 2:212124649-212124671 GGCAGAAGAGCACCCCTTCCAGG + Intronic
948342012 2:237260982-237261004 GACTGAACAACACCTTTTAGAGG + Intergenic
1169023356 20:2347343-2347365 GAGAGTAGGGCACCTTCTACTGG + Intergenic
1169447974 20:5688350-5688372 GCAAGAAGAGCACCTGCTACAGG - Intergenic
1169539329 20:6582116-6582138 GCCAGAAGAGCACCTACCACAGG - Intergenic
1174618655 20:51856671-51856693 GACAGAACAGCAGCTTATAGAGG - Intergenic
1178438084 21:32576814-32576836 GACAGAAGAGCAACACCTACTGG - Exonic
1183644505 22:39116206-39116228 GACAGTCTAGCACCTTTTAAAGG + Intergenic
950831586 3:15879933-15879955 GCCAGGAGAGCACCATTTCCTGG - Intergenic
951604414 3:24416998-24417020 GAAAGAAAAGTAGCTTTTACAGG + Intronic
957245960 3:77716530-77716552 GGGAGAAGAGGACCTCTTACAGG - Intergenic
957555430 3:81760704-81760726 GTCAGGAAAGCAACTTTTACAGG - Intronic
961487561 3:127227441-127227463 GACAGAGGTGGACCTTTGACAGG - Intergenic
964465519 3:156987398-156987420 AACAGAAGAACTCCTTTTAGTGG - Intronic
968708119 4:2093142-2093164 CAGAGAAGACCACCTTTTTCTGG + Intronic
969105378 4:4803525-4803547 GAGAGAGGAGCACCTTAGACAGG - Intergenic
971637640 4:29083016-29083038 GACAGCTGAGAACCTTGTACAGG - Intergenic
971882657 4:32398317-32398339 GACAGAAGAGATTCTGTTACAGG - Intergenic
973108397 4:46369319-46369341 GACAGAAGTTCACATTTTATTGG + Intronic
974108430 4:57498287-57498309 TCCACAAGAGCACCTTTAACTGG - Intergenic
975869868 4:78768108-78768130 GACAGAAAAGCAGCTTTTGTCGG - Intergenic
979053429 4:115966151-115966173 GGCACAATAGAACCTTTTACAGG + Intergenic
980036531 4:127889250-127889272 TACAGAACAGTATCTTTTACAGG - Intronic
984989044 4:185360624-185360646 GACAGCAGAGGACCTGTAACTGG + Intronic
986033005 5:3910755-3910777 GAATGAAAAGCACCTTTTCCTGG + Intergenic
988476715 5:31592498-31592520 GACAGATGTGCTCATTTTACTGG - Intergenic
988927005 5:35999972-35999994 GACAGAGGAACTCATTTTACTGG + Intergenic
990714119 5:58617432-58617454 GACAGAATAGCAAATCTTACAGG - Intronic
992211070 5:74479983-74480005 GACAGAAGAGCAGGTGTTAATGG + Intergenic
993596953 5:89869294-89869316 TACAGGAGAGCATCTTTCACTGG + Intergenic
995880920 5:116843915-116843937 GAAAGAAGATTACCATTTACAGG - Intergenic
998124978 5:139612304-139612326 CACAGGAGTGCACCCTTTACTGG - Intronic
998565319 5:143211411-143211433 GACAGAAGAGGTGCTTTTAAAGG - Intronic
999587464 5:153106804-153106826 GACCAAAGAGAACCTTTTTCAGG - Intergenic
999809766 5:155116442-155116464 AACAGAATAGCACCACTTACTGG - Intergenic
1001299297 5:170522525-170522547 GACAGATGAGTCCCTTTTGCTGG + Intronic
1001745948 5:174092363-174092385 GGCAGAAAAGCACCTTTGACAGG - Intronic
1003632457 6:7800486-7800508 GACAGAAGAAGAGCTTTTTCAGG - Intronic
1004433444 6:15567061-15567083 GAGAGTATAGCACCTTTTAAAGG + Intronic
1004731785 6:18366347-18366369 GCCAGGAGAGCACCATTTCCTGG + Intergenic
1004923881 6:20401605-20401627 GGCAGAAGAGCAGTTTTTAGGGG - Intergenic
1007464799 6:42044207-42044229 GACAGAAGAGCACCTTTTACGGG + Intronic
1009728472 6:67565583-67565605 TACAGAAGAGGACATTTTCCTGG + Intergenic
1012574292 6:100772702-100772724 GACAGTACAGCACATTTTTCAGG + Intronic
1014130173 6:117821866-117821888 GACAGCTGAGCACATTTCACAGG + Intergenic
1021180916 7:17504765-17504787 GACAAAACAGCAGCTTCTACAGG - Intergenic
1024266200 7:47608540-47608562 AGCCGAAGAGCACCTTCTACTGG + Intergenic
1024790906 7:52964010-52964032 GACAGGAGAACACATTTCACAGG - Intergenic
1026562226 7:71459780-71459802 GACAGTCTAGCACCTTTTAAAGG + Intronic
1031896118 7:127349836-127349858 GACAGAAGAGCATTTATTATTGG + Intronic
1032018127 7:128392617-128392639 GCCAGGAGAGCACCATTTCCTGG + Exonic
1033097338 7:138442591-138442613 GCCAGGAGAGCACCATTTCCTGG - Intergenic
1034012422 7:147544293-147544315 CACAGAAGAGCACATTTCAATGG + Intronic
1034604153 7:152295454-152295476 GACAGAGGGTCACCCTTTACAGG - Intronic
1043291705 8:78610215-78610237 GAGAGAAAAGGACCTTTTATAGG + Intergenic
1045960252 8:107959072-107959094 GACAGAAGACAAAATTTTACAGG + Intronic
1047275592 8:123402468-123402490 GCCAGGAGAGCACCATTTCCTGG - Intronic
1048152459 8:131907367-131907389 AATAAAAGAGCACATTTTACCGG - Intronic
1049475185 8:142793988-142794010 GACAGAGGAGCAACTCTGACGGG + Intergenic
1052941101 9:34132793-34132815 GCCAGGAGAGCACCATTTCCTGG + Intergenic
1053623417 9:39843822-39843844 GACAGAGGATCACATTTCACTGG - Intergenic
1053881451 9:42599406-42599428 GACAGAGGATCACATTTCACTGG + Intergenic
1054220482 9:62406877-62406899 GACAGAGGATCACATTTCACTGG + Intergenic
1054230233 9:62502295-62502317 GACAGAGGATCACATTTCACTGG - Intergenic
1054770457 9:69078552-69078574 GTCAGAAAAGCACATTTTTCAGG - Intronic
1055381623 9:75713523-75713545 GACAGGAAAGCACCTTCTAATGG + Intergenic
1056320232 9:85428873-85428895 GACAGAAGAGCACCTTGTTGTGG + Intergenic
1186761628 X:12729442-12729464 GCCACAAGGGCACCTTTAACAGG + Intergenic