ID: 1007464800

View in Genome Browser
Species Human (GRCh38)
Location 6:42044208-42044230
Sequence ACAGAAGAGCACCTTTTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464796_1007464800 -7 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464800 6:42044208-42044230 ACAGAAGAGCACCTTTTACGGGG No data
1007464794_1007464800 7 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464800 6:42044208-42044230 ACAGAAGAGCACCTTTTACGGGG No data
1007464791_1007464800 22 Left 1007464791 6:42044163-42044185 CCGCAGAGGCGGAGGCCTGCACG 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1007464800 6:42044208-42044230 ACAGAAGAGCACCTTTTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464800 Original CRISPR ACAGAAGAGCACCTTTTACG GGG Intronic
No off target data available for this crispr