ID: 1007464801

View in Genome Browser
Species Human (GRCh38)
Location 6:42044209-42044231
Sequence CAGAAGAGCACCTTTTACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464794_1007464801 8 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464801 6:42044209-42044231 CAGAAGAGCACCTTTTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1007464796_1007464801 -6 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464801 6:42044209-42044231 CAGAAGAGCACCTTTTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1007464791_1007464801 23 Left 1007464791 6:42044163-42044185 CCGCAGAGGCGGAGGCCTGCACG 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1007464801 6:42044209-42044231 CAGAAGAGCACCTTTTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464801 Original CRISPR CAGAAGAGCACCTTTTACGG GGG Intronic
908022353 1:59911242-59911264 CAGAAGAGAACCTCTGAGGGAGG + Intronic
914256502 1:145964337-145964359 CTAAAGAGCAGCTTTTACAGAGG + Exonic
924841471 1:247714154-247714176 CAGAGGAGCACATTTTATGGTGG - Intergenic
1063087921 10:2836324-2836346 CAGAAGAGCTCTTCTTACGGAGG - Intergenic
1065684960 10:28275246-28275268 CAGAAGAGCACGTCTTGGGGAGG - Intronic
1072556398 10:96517458-96517480 CATAAGAGCACCTTTAGCTGTGG + Intergenic
1072804699 10:98417181-98417203 CAAAGGAGCACCTTTTACCTGGG + Exonic
1073477895 10:103766288-103766310 CAGAAGAGCTCCCTTCACAGTGG - Intronic
1074629999 10:115242492-115242514 CTTAAGAGCACCTTTTATTGAGG + Intronic
1076046477 10:127298269-127298291 CAGATGAGCCCCTTTTTTGGGGG + Intronic
1076548714 10:131263613-131263635 CAGAACAGCACCTATTACGATGG - Intronic
1082974932 11:59061933-59061955 CTGAGGAGCACCTTTTACCAGGG + Intergenic
1082979358 11:59105667-59105689 CTGAGGAGCACCTTTTACCAGGG + Intergenic
1087327887 11:96745817-96745839 CTCAACAGCACCTTTTACAGAGG - Intergenic
1091723989 12:2833216-2833238 CAGTAGAGCACCTTCTCCTGGGG + Intronic
1091821442 12:3478492-3478514 CAGAAGAGAACCTTGTACCTTGG + Intronic
1092784470 12:12015067-12015089 AAGAAGAGCACTTTTTGAGGAGG + Intergenic
1097274387 12:57802338-57802360 CACAAGAACACCTGTTAAGGTGG + Exonic
1099775324 12:87120052-87120074 CAGAAGCACATCTTTTACTGAGG - Intergenic
1099798812 12:87431602-87431624 CAGAAAAGCACCTTATACAAAGG - Intergenic
1099928023 12:89041420-89041442 CAGAAGAGTACCCTTTGGGGTGG - Intergenic
1102707430 12:114894414-114894436 CAGCAAAGCACCTTTTTCTGAGG - Intergenic
1104294060 12:127495722-127495744 CAGAAGGGCAGCTTGTAGGGAGG + Intergenic
1113428989 13:110232915-110232937 CAAAAGGGCAGATTTTACGGTGG + Intronic
1117063811 14:51989195-51989217 TAGAAGAGCACCTGTTATGTAGG + Intergenic
1119469171 14:74882969-74882991 CAGAAGAGCCCTTTTTGAGGAGG + Intronic
1120654467 14:87172181-87172203 CTGAAGAGCTCCTTTTATGCAGG + Intergenic
1129040508 15:72682320-72682342 GAGAAGAGCATCTTTTCTGGGGG - Intronic
1130397191 15:83512810-83512832 CAGAATAGCACCTCATCCGGAGG - Intronic
1146262220 17:31429523-31429545 CAGGAGACCAATTTTTACGGAGG - Intronic
1164633200 19:29774903-29774925 CAGAAGGGCACCTTTTCCTGAGG - Intergenic
1166988921 19:46678866-46678888 CAGAAGAGCACCTATCTCAGAGG + Intronic
1167838499 19:52095097-52095119 CGGAAGAGCACATTTTCCAGTGG + Intronic
1167843221 19:52139219-52139241 CGGAAGAGCACATTTTCCAGTGG + Intronic
934013748 2:87855602-87855624 CAGAAGAGCACTTTTTTTTGGGG + Intergenic
935344694 2:102095621-102095643 CAGAAGAGCAGCTATTTCTGGGG - Intronic
937927315 2:127177127-127177149 CAGAGAGGCACCCTTTACGGAGG + Intergenic
938213097 2:129485192-129485214 GAGAAGAGCTCCTTTTGTGGAGG + Intergenic
942979582 2:182063780-182063802 CTGAACAGTACCTTTTATGGTGG - Exonic
944581567 2:201137128-201137150 CAGGAGAGCACCATTTCCTGGGG + Intronic
1175617039 20:60408484-60408506 CTGAAGAACACCTTTTCCTGGGG - Intergenic
1178035020 21:28570889-28570911 CAGAAGAGTGCCTTGTATGGTGG - Intergenic
1181137782 22:20781127-20781149 CACAAGGGCACTTTTTAAGGAGG + Intronic
950831583 3:15879931-15879953 CAGGAGAGCACCATTTCCTGGGG - Intergenic
953406796 3:42663736-42663758 CAGAAGAGCAGCCTTTGTGGAGG - Intronic
953473248 3:43184475-43184497 CCGAAGAGCTCCTTCTAGGGAGG + Intergenic
954909365 3:54090095-54090117 CACTAGAGGACCTGTTACGGTGG - Intergenic
956788890 3:72665276-72665298 CTGAAGGGCACCTTTGACGCTGG + Intergenic
964556333 3:157943848-157943870 CAGAAGAGCACACTTTAAAGAGG + Intergenic
975420086 4:74153686-74153708 CAGAAGAGAATCTTTAAAGGTGG - Intronic
981822751 4:148904408-148904430 CAGAAGACCTCCTTTTATGCTGG + Intergenic
981856092 4:149294712-149294734 AAGAAGAGCACATTTTCCGTGGG - Intergenic
987061010 5:14243950-14243972 CAGAAGGGCTCCTCTTAGGGAGG + Intronic
999148660 5:149412428-149412450 CAGAGGAGGAGCTTTTAAGGAGG - Intergenic
1002668865 5:180848832-180848854 CAGAAGAGAACCTATGAGGGAGG - Exonic
1004731788 6:18366349-18366371 CAGGAGAGCACCATTTCCTGGGG + Intergenic
1007464801 6:42044209-42044231 CAGAAGAGCACCTTTTACGGGGG + Intronic
1020553127 7:9633228-9633250 CGGAAGAATACCTTTTAGGGTGG - Intergenic
1024323640 7:48092212-48092234 CAGAGGAGCCACTCTTACGGGGG + Intronic
1033097335 7:138442589-138442611 CAGGAGAGCACCATTTCCTGGGG - Intergenic
1034455060 7:151165636-151165658 CAGAATAGCATCTTCTAAGGGGG - Intronic
1036569700 8:9969323-9969345 GAGCAGAGCACCTTTTCCTGGGG + Intergenic
1037639714 8:20731480-20731502 CAAAAGAGCAGCTTTTAGGTGGG + Intergenic
1044532645 8:93325159-93325181 AAGCAGAGCACCTTCTACGTTGG + Intergenic
1044710047 8:95048467-95048489 CACAAGAGGACTTTCTACGGAGG + Exonic
1046203711 8:110960511-110960533 CAGAATAGCAGTTTTTATGGGGG + Intergenic
1046555357 8:115767681-115767703 CTGAAGAGCACCATTTCAGGTGG + Intronic
1047275589 8:123402466-123402488 CAGGAGAGCACCATTTCCTGGGG - Intronic
1052941104 9:34132795-34132817 CAGGAGAGCACCATTTCCTGGGG + Intergenic
1055417190 9:76096581-76096603 AAGAAACGCACCTTTTACAGAGG - Intronic
1057044467 9:91874226-91874248 CCACAGAGCACCTTTTACTGGGG - Intronic
1188029550 X:25249051-25249073 CCGAAGAGCACCTTCTAAGCTGG + Intergenic
1188092920 X:25985682-25985704 CAGTAGACCACCTTTGAAGGAGG + Intergenic
1188169684 X:26909772-26909794 CAGAAGAGCACTCTTTTCAGAGG + Intergenic
1199130727 X:144182871-144182893 CAGAAGAGCACTTTTTTTTGGGG - Intergenic